Agathacrista, as proposed here, includes two previously described species, both of which were included in the paraphyletic concepts of Bassus s.l. and Therophilus s.l. This paper is part of a series that investigates these non-monophyletic taxa, while describing taxa from Thailand, Costa Rica, or more inclusive areas of the world.

Morphological terms: The length of the first metasomal tergite is measured from the apex of the tendon emanating from the propodeum to the posterior border of the tergite. Other terms are from Sharkey and Wharton (1997).

Museum acronyms

HIC Hymenoptera Institute Collection, University of Kentucky, Department of Entomology, Lexington, Kentucky, USA.

QSBG Queen Sirikit Botanic Gardens, Chiang Mai, Thailand.

TARI Taiwan Agricultural Research Institute, Entomology Collection, Taichung, Taiwan.

Species description format: Descriptions are of the holotype; variation is given in parentheses. In the species descriptions color is not extensively described because the images serve this purpose; however color characters that are variable or of diagnostic significance are detailed.

Species delimitation: The five species from Thailand treated here are very similar morphologically and are represented by only seven specimens. The seven specimens do not differ more than might be expected within one species of agathidine. In part, we relied on 28S sequence data to separate species. We did not employ any particular cut-off point in differences in 28S but rather calibrated the amount of sequence difference using species that exhibit significant morphological and host preference differences. This calibration comes from a large dataset of about 1, 000 agathidine specimens for which we have 28S data. The three species of Agathacrista for which we have 28S sequences were identified according to this criterion. Morphological characters also played an important role in species delimitation. We examined ten specimens of Agathacrista cancellata (Enderlein, 1920), all from Taiwan. Body color varies considerably in this species, but wing color and the sculpture and dimensions of the first metasomal median tergite are uniform, suggesting that these are good species indicators within the genus. Therefore, these characters played an important role in our species concepts. Agathacrista depressifera (van Achterberg & Long, 2010) displays considerable variation in wing color-pattern. Despite the fact that we have some evidence to suggest that this species concept may include more than one species, our evidence is weak and not convincing enough to suggest changes. This revision of Agathacrista is very preliminary; many more specimens will be needed to fully understand species limits and species diversity.

Generic concepts: This is the fourth of a series of papers (Sharkey and Clutts 2011; Sharkey and Stoelb 2012; Sharkey et al. 2009) that reclassify what was once considered the genus Bassus (or Microdus, or Agathis s.l.). I (MJS) thought it best to give some details here on the criteria that were used to delineate generic limits. Most of these are stated in one manner or another in Backlund and Bremer (1998). The first consideration is monophyly and this is why the polyphyletic concept of Bassus s.l. was rejected (Sharkey et al. 2009). The following criteria are in no particular order and may be more or less important depending on the genus.

Identifiability: Agathacrista is a good example of the utility of this criterion. Agathacrista, Bassus s.s. and a new genus to be described in a forthcoming paper, form a monophyletic group (Fig. 2). The only morphological synapomorphy to aid in the recognition of the group is the presence of small spines or pegs on the fore tibia; convergent in some members of Earinus and many other non-agathidines. If there was an easily observed character it might be best to expand the concept of Bassus to include Agathacrista and the new genus. Conversely, all three genera as here proposed have distinguishing characteristics. Bassus s.s. has long, simple claws that lack a basal lobe; Agathacrista has a crest between the antennae and the undescribed new genus has a distinct longitudinal carina on the hind trochanter, a character formerly thought to be restricted to some members of the Cremnoptini and Disophrini.

Biological information content: Typically the more that is known about organisms the more finely split the higher ranks are. This criterion has little application to any agathidines since we know so little about their natural history. Undoubtedly the morphological autapomorphies of the three genera referred to above will be shown to relate to unique behaviours.

Stability: This is somewhat tied to most other criteria and Bassus s.l. is a good example of an unstable concept. Over the years it has been included in the genus Agathis s.l. and numerous genera like Camptothlipsis and Therophilus have been included, or not. This instability has made information retrieval on any particular species rather cumbersome, as the number of different combinations they have been referred to is a minimum of three, i.e., Microdus, Bassus, Agathis, the foremost being a junior objective synonym of Bassus. Thus, generic concepts should be accompanied by solid phylogenetic evidence when such is available.

Phylogenetic evidence: This is directly related to stability. If new, but weak evidence suggests the non-monophyly of a well-recognized genus, it is usually best to wait for more data before making formal changes. In the case presented here, there is strong molecular phylogenetic evidence suggesting that the broad concept of Bassus (Bassus s.l.) is polyphyletic and there is significant morphological and molecular evidence for the monophyly of Agathacrista.

Specimen collection: As part of the inventory of Thai insects, 3 Malaise traps at each of 30 different localities throughout Thailand were operated from 2007-2010, comprising approximately 90 trap-years. The specimens dealt with here are primarily from these traps.

Phylogenetic methods: Regions D2-D3 of 28S rDNA (roughly 560 base pairs) were sequenced using the following primers: 28SD2hymF 5’ - AGAGAGAGTTCAAGAGTACGTG - 3’ and 28SD3hymR 5’ - TAGTTCACCATCTTTCGGGTC - 3’. Sequences were edited using Geneious Pro v4.7.5 (Drummond et al. 2009) and aligned based on a secondary structure model for Ichneumonoidea developed by Yoder and Gillespie (2004) and Gillespie et al. (2005). Regions of expansion and contraction (RECs), regions of slipped-strand compensation (RSCs), and short regions of alignment ambiguity were further aligned/corrected by eye. Three of these regions (~30 base pairs) were deleted because they could not be aligned with confidence, i.e., there were multiple equally supported alignment options.

The NJ analysis (Fig. 1) was conducted with PAUP* (Swofford 2003) using default settings. The parsimony analysis (Fig. 2) was performed using TNT (Goloboff et al. 2008) [traditional search with 100 random addition sequences followed by branch-swapping, saving 100 trees per replication; 1000 bootstrap replications were used to estimate branch reliability].

Morphological terms used in this revision were matched to the Hymenoptera Anatomy Ontology (HAO; Yoder et al. 2010, Appendix 4). Identifiers (URIs) in the format http://purl.obolibrary.org/obo/HAO_XXXXXXX represent anatomical concepts in HAO version http://purl.obolibrary.org/obo/hao/2011-05-18/hao.owl. They are provided to enable readers to confirm their understanding of the anatomical structures being referenced. To find out more about a given structure, including images, references and other metadata, use the identifier as a web-link, or use the HAO:XXXXXXX (note colon replaces underscore) as a search term at http://glossary.hymao.org.

All species are treated with a diagnosis and distributional data. They are illustrated with color photos using a JVC digital camera mounted on a Leica MZ16 microscope and Automontage® stacking software. Distributional data are listed for all species and a link to a Google map is included for all species. The descriptions are of holotypes and variation is given in parentheses.

Sharkey et al. (2006) showed that the entities formerly referred to as Bassus s.l. fall into two widely disparate clades. One associated with the genus Mesocoelus, Therophilus and allies and the other with Bassus s.s., Agathis, Alabagrus, Braunsia and allies. Agathacrista falls into the latter lineage. It is sister to Bassus s.s. + a new genus to be described in another paper. All three genera are restricted to the Old World, and except for one species of Bassus s.s., Bassus calculator Fabricius, 1798, the type species, which is widely distributed throughout the Palearctic, all are restricted to the Oriental region, the northern, tropical parts of the Australian region, and the far eastern Palearctic.

Members of all three genera have distinct pegs on the anterior surface of the fore tibia (Fig. 3a), a synapomorphy. This character state is convergent in some members of the distantly related genus Earinus (Agathidinae), some Braconinae, most Doryctinae, and has rare and scattered appearances in other braconid subfamilies. Members of Agathacrista and Bassus have similar and rather unique color patterns (see Figs 4–8). The thin, acute, interantennal crest (Fig. 3b) is an autapomorphy for Agathacrista that is found convergently though rarely in a few other agathidine genera, e.g., a few members of Therophilus.