Corresponding author: Michael J. Sharkey (
Academic editor: Gavin Broad
Based on a phylogenetic analysis,the limits of
Agathidinae is a moderately large subfamily of
As part of the inventory of Thai insects, we ran 3 Malaise traps at each of 30 different localities throughout Thailand from 2007-2010, comprising approximately 90 Malaise traps. The specimens dealt with here are primarily from these traps.
Species concepts are based on morphological data and 28S rDNA data. Regions D2-D3 of 28S rDNA (roughly 560 base pairs) were sequenced using the following primers: 28SD2hymF 5’ - AGAGAGAGTTCAAGAGTACGTG - 3’ and 28SD3hymR 5’ - TAGTTCACCATCTTTCGGGTC - 3’. Sequences were edited using Geneious Pro v4.7.5 (
Phenetic and phylogenetic trees were constructed using neighbor-joining (NJ), maximum parsimony (MP) and Bayesian methods. MP was performed using TNT (
Map showing
NJ phylogram based on 28S rDNA. Where Bayesian and parsimony analyses agreed with the NJ tree, branch support values are included in the figure, i.e., Bayesian posterior probabilities/parsimony bootstrap (values below 0.5 posterior probability and/or 50% bootstrap support were not recorded on the tree).
The dichotomous key, descriptions, and the interactive key (Appendices 1–3) were generated using DELTA Editor (
Morphological terms follow
Morphological terms used in this revision were matched to the Hymenoptera Anatomy Ontology (HAO,
All 14 species found in Thailand are treated with a diagnosis and distributional data. They are illustrated with color photos using a JVC digital camera mounted on a Leica MZ16 microscope and Automontage® stacking software. Distributional data are listed for all species and a Google map via Berkeley Mapper is included for all species. The descriptions are of the holotype and variation is given in parentheses.
The source files for the keys, descriptions, illustrations, DNA sequence and distributional data are all freely available to future researchers who may wish to build on these data. Distribution data, pdf’s of non-copywrite references, images, notes, and host and type information can be found by searching Taxabank (a combined specimen and taxonomic database;
Recently the polyphyletic generic concept,
The phylogenetic tree in
Within
There is neither one character nor a specific combination of characters that distinguishes members of
Including the twelve described here, there are 44 described species known to the senior author. The following 13 species were included in
The remainder are here transferred to
According to
Worldwide, with more diversity in subtropical and tropical areas.
1 | a. Tegula black, concolorous with mesoscutum | 2 |
b. Tegula yellow, contrasting with predominantly black mesoscutum | 8 | |
c. Tegula yellow or orange, similar in color to predominantly orange or yellow mesoscutum | 12 | |
|
||
2(1) | a. Hind tibia entirely melanic (check medial surface) | |
b. Hind tibia largely pale, melanic apically and with a subbasal melanic band or lateral spot | 3 | |
c. Hind tibia mostly pale, melanic apically only | ||
d. Hind tibia mostly melanic with pale coloration at midlength at least medially | ||
|
||
3(2) | a. 2nd submarginal cell reduced to a small dot, petiole longer than cell is high | 4 |
b. 2nd submarginal cell larger, cell height subequal to petiole length | 6 | |
|
||
4(3) | a. Fore tarsus mostly or entirely melanic | 5 |
b. Fore tarsus mostly or entirely pale | ||
|
||
5(4) | a. Exposed portion of ovipositor distinctly longer than body | |
b. Exposed portion of ovipositor slightly shorter than body | ||
|
||
6(3) | a. Pronotum entirely melanic | 7 |
b. Pronotum mostly melanic but pale dorsomedially | ||
|
||
7(6) | a. Posterior half of MT2 smooth | |
b. Posterior half of MT2 longitudinally striate, at least medially | ||
|
||
8(1) | a. MT2 mostly smooth with transverse and/or diagonal striae in and/or near transverse depression | |
b. MT2 mostly smooth with short longitudinal striae restricted to transverse depression… | ||
c. MT2 entirely smooth | 9 | |
d. MT2 smooth in most of anterior half anteriad transverse groove, longitudinally striate in transverse groove and area posteriad transverse groove, at least medially. | 10 | |
|
||
9(8) | a. MT2 entirely melanic | |
b. MT2 entirely or almost entirely pale | ||
|
||
10(8) | a. MT2 entirely melanic | 11 |
b. MT2 pale in anterior half, melanic posteriorly | ||
|
||
11(10) | a. Mid femur mostly or entirely melanic, usually pale distally | |
b. Mid femur entirely or mostly pale, usually melanic at extreme base | ||
|
||
12(1) | a. Ocellar triangle pale, concolorous with remainder of vertex | 13 |
b. Ocellar triangle melanic, contrasting with most of vertex | ||
|
||
13(12) | a. MT1 length distinctly longer than apical width | |
b. MT1 length only slightly longer than apical width | ||
|
Ocellar triangle melanic, concolorous with remainder of vertex. Hind tibia entirely melanic. Strong transverse carinae between the hind coxal cavities and a wide sclerite between the hind coxal and metasomal foramina. Strong, sharply declivous longitudinal flange between antenna; hind wing CUb strong and long; median lobe of mesoscutum sharply sloping anteriorly.
Named in honor of Mr. Anuchat Chaimuangchuen, collector for the TIGER project at Huay Namdung National Park.
H099, GenBank Accession:
Distribution map can be found at
Holotype ♂. H099 [QSBG] Thailand, Phu Ruea NP, Nature trail, 920m,
MT2 pale in anterior half, melanic posteriorly. Ocellar triangle melanic, concolorous with remainder of vertex.
Named in honor of Mr. Apichat Watanawanit, collector for the TIGER project at Doi Chiangdao Wildlife Sanctuary.
H147, GenBank Accession:
Distribution map can be found at
Holotype ♀. H147 [QSBG] Thailand, Khao Kho NP, Mixed deciduous forest, 560m,
MT2 smooth in most of anterior half anteriad transverse groove, longitudinally striate in transverse groove and area posteriad transverse groove, at least medially. Mid femur mostly pale with a bit of melanic color at extreme base. MT2 entirely melanic. Similar to
Named in honor of Ms. Yuwadee Areeluck, collector for the TIGER project at Doi Inthanon National Park.
Distribution map can be found at
Holotype ♀. H988 [QSBG] Thailand, Chae Son NP, Youthcamp/meeting hall, 476m,
Ocellar triangle melanic, contrasting with remainder of vertex, which is pale. Hind tibia mostly melanic, pale color restricted to extreme base.
Named in honor of Mr. Tawatchai Boontham, collector for the TIGER project at Huay Namdung National Park.
H633, GenBank Accession:
Distribution map can be found at
Hind tibia mostly melanic with pale coloration restricted to the medial surface at midlength. Wings relatively deeply infuscate.
Named after the province in which the type specimen was collected.
H1853, GenBank Accession:
Distribution map can be found at
Holotype ♀. 1853 [QSBG] Thailand, Chiang Mai, Doi Phahompok NP, Kiewlom1: Montane Forest,
Ocellar triangle pale, concolorous with remainder of vertex. Scape at least partly pale, especially anteriorly.
The Thai specimens differ from the holotype only in the color of the metapleuron which is yellow-brown in the type and melanic in all Thai specimens. This same variation is found in Vietnamese males described by
H024, GenBank Accession:
Distribution map can be found at
♀. Thailand: Doi Inthanon NP: Vachirathan Fall, 700m,
Tegula black, concolorous with mesoscutum. 2nd submarginal cell height subequal to petiole length. Hind tibia mostly pale, melanic apically and with a subbasal melanic band or lateral spot. Pronotum entirely melanic. MT2 with weak short longitudinal striae restricted to transverse depression, or entirely smooth.
The Thai specimen has a slightly longer ovipositor, otherwise very similar to type.
Distribution map can be found at
2nd submarginal cell reduced to a small dot, petiole longer than cell is high. Tegula black, concolorous with mesoscutum. Fore tarsus entirely pale.
Named in honor of Ms. Boonruen Kwanui, collector for the TIGER project at Chae Son National Park
Distribution map can be found at
Holotype ♀. H927 [QSBG] Thailand, Huai Nam Dang NP, Visitor center,
Paratype ♀. H5524 [QSBG] Thailand, Chiang Mai , Huai Nam Dang NP, Thung Buatong View Point ,
Ovipositor clearly shorter than body, about as long as Metasoma. Hind tibia mostly pale, melanic apically and with a subbasal melanic band or lateral spot.
H235, GenBank Accession:
♀. H235 [QSBG] Thailand, Huai Nam Dang NP, behind visitor house, 1670m,
Ocellar triangle pale, concolorous with remainder of vertex. Tegula yellow or orange, similar in color to predominantly orange or yellow mesoscutum. MT1 distinctly longer than apical width.
Named in honor of Mr. Songran Chaksu, collector for the TIGER project at Doi Chiangdao Wildlife Sanctuary.
H352, GenBank Accession:
Distribution map can be found at
Holotype ♀. H352 [QSBG] Thailand, Queen Sirikit Botanic Garden, 811m,
MT2 smooth in most of anterior half anteriad transverse groove, longitudinally striate in transverse groove and area posteriad transverse groove, at least medially. Tegula black, concolorous with mesoscutum.
Named in honor of Ms. Acharaporn Sukpeng collector for the TIGER project at Chae Son National Park.
Distribution map can be found at
Holotype ♀. H998 [QSBG] Thailand Pu Toei NP, Protection unit2/Pu Krathing, 220m,
MT2 with short longitudinal striae restricted to transverse depression. Mid femur mostly melanic, pale apically. Fore tarsus mostly pale, melanic basally. Pronotum mostly melanic but with a pale spot dorsomedially.
Named in honor of Mr. Charoen Wanna, collector for the TIGER project at Doi Phuka National Park.
Distribution map can be found at
Holotype ♀. H345 [QSBG] Thailand Doi Phu Kha NP, Office 11, 1359m,
Ocellar triangle melanic, contrasting with remainder of vertex, or pale, concolorous with remainder of vertex. Tegula yellow, contrasting with black lateral lobes of mesoscutum. Hind tibia largely pale, melanic apically and with a subbasal melanic band or lateral spot, or mostly pale, melanic apically only.
Named in honor of Mr. Prasit Wongchai, collector for the TIGER project at Doi Phahompok National Park.
H314, GenBank Accession:
Distribution map can be found at
Holotype ♀. H314 [QSBG] Thailand, Kaeng Krachan NP,km33/helipad, 735m,
Paratypes ♀. Thailand: Kaeng Krachan NP: km33/helipad, 735m,
2nd submarginal cell reduced to a small dot, petiole longer than cell is high. Tegula black, concolorous with mesoscutum. Fore tarsus mostly melanic with some pale color apically. Exposed portion of ovipositor distinctly longer than body.
Named in honor of Mr. Nikom Wongwan, collector for the TIGER project at Doi Phuka National Park.
H028, GenBank Accession:
Distribution map can be found at
Holotype ♀. H028 [QSBG] Thailand, Doi Inthanon NP, Summit marsh, 2500m,
Paratypes ♀. Doi Inthanon NP, Summit marsh, 2500m,
We thank all of the staff at Queen Sirikit Botanic Gardens in Chiang Mai for sorting the many hundreds of samples and for the Thai park staff for running Malaise traps and other collection devices. Thanks to Dr. van Achterberg for the loan of type specimens. A special thanks to Chaweewan Hutacharern for managing the Thai end of the TIGER project. Funding was provided by NSF grants DEB-0542864 and EF-0337220.
DELTA data matrix, images, and other files to the dichotomous key for
DELTA data matrix, images, and other files to species descriptions for
Interactive key, in IntKey format, to
You also need to download Intkey software and reboot your computer, if it is not already installed. The software package, Intkey, can be downloaded from
More details on how to use Intkey efficiently are found at
Morphological terms matched to the Hymenoptera Anatomy Ontology. Identifiers (URIs) represent anatomical concepts in HAO version
|
|
---|---|
abscissa |
|
anatomical structures |
|
angle |
|
antenna |
|
antennal insertions |
|
antennomere |
|
area |
|
band |
|
basal lobe |
|
body |
|
carina |
|
cell |
|
costa |
|
coxa, coxae |
|
coxal cavities |
|
crossveins |
|
cubitus |
|
depression |
|
eye |
|
femur |
|
flagellomeres |
|
flange |
|
metasomal foramen |
|
fore leg |
|
fore tarsus |
|
fore tibia |
|
fore wing |
|
frons |
|
galea |
|
gena |
|
groove |
|
head |
|
hind coxa |
|
hind femur |
|
hind leg |
|
hind tibia |
|
hind trochanter |
|
hind wing |
|
labial palpus |
|
labrum |
|
lateral lobes |
|
laterotergite |
|
leg |
|
leg segment |
|
lobe |
|
mandible |
|
margin |
|
median lobe of mesoscutum | |
mediotergite |
|
mesoscutum |
|
mesosoma |
|
metapleuron |
|
metasoma |
|
mid femur |
|
mid leg |
|
mid tibia |
|
mouthparts |
|
notaulus |
|
occiput |
|
ocellar triangle |
|
ovipositor |
|
palpus |
|
patch |
|
petiole |
|
pit |
|
posterior scutellar depression |
|
process |
|
projection |
|
pronotum |
|
propleuron |
|
propodeum |
|
prothorax |
|
region |
|
ridge |
|
scape |
|
sclerite |
|
sculpture |
|
scutellum |
|
segment |
|
seta |
|
spot |
|
spur |
|
sternite |
|
stigma |
|
suture |
|
tarsal claw |
|
tarsomeres |
|
tarsus |
|
tegula |
|
tendon |
|
tergum |
|
tergite |
|
thorax |
|
tibia |
|
tibial spur |
|
trochanter |
|
vein |
|
vertex |
|
wing |
|
wing vein |
|