The source for all specimens in this study resulted from the combined rearing efforts of collaborators from around the world, as well as researchers with established Ganaspis spp. laboratory colonies for genetic research; these collaborators are listed in Suppl. material 1: table S1 as well as in the acknowledgments. As specimens were reared in the field or the lab, a subset of specimens was sent to one of us (MLB) for morphological determination and vouchering in the National Museum of Natural History, Smithsonian Institution (USNM); these were typically dry mounted and labeled, but some were retained in 95% ethanol. In some cases, large numbers of specimens were sent and kept in 95% ethanol. Outgroups included were Ganaspis hookeri (Crawford, 1913) (from a laboratory colony), two other undescribed, but morphologically distinct, species of Ganaspis, that were bred true from a laboratory colony, and specimens identified as belonging to the eucoiline genus Leptopilina Föster.

Representative specimens were imaged using the Macropod®™ multiple-focus imaging system to illustrate diagnostic characters; single montage images were produced from image stacks with the program Zerene Stacker®™. Scanning electron micrographs were generated using a Hitachi®™ TM3000 desktop scanning electron microscope; specimens were coated in 25–30 nm gold-palladium alloy (Cressington®™ 108 auto sputtercoater), using ‘analysis’ voltage, running in ‘compo’ mode. Diagnoses focus on easily recognized gross morphologies, and species/genera that can be confused with G. brasiliensis are diagnosed. Terminology for all descriptive characters, as well as phylogenetic characters, follow Buffington and Forshage (2016).

DNA was extracted using the Qiagen DNeasy® Blood and Tissue Kit (Qiagen, Valencia, CA, U.S.A.). DNA extractions were performed by either placing an entire individual (male or female) or their metasoma, in a 2 mL tube with 0.5 mm diameter glass lysis beads (BioSpec Products, Bartlesville, OK, U.S.A.). The samples were placed in a -20 °C freezer for ~10 minutes and then placed in a TissueLyser II (Qiagen Inc., USA) for 30 s at 30 Hz to disrupt the tissue and facilitate the lysis process. Cell lysis was performed overnight with 20 µL of Proteinase K in a dry bath shaker at 56 °C and at 500 rpm. The recommendations of the manufacturer were followed for the extraction process except that the cleaned, extracted DNA from the spin-collection columns was eluted with two (rather than one) washes, each consisting of 55 µL of nuclease-free water, differing from the manufacturer’s recommendation of 200 µL of AE buffer. DNA extractions were quantified using 2 µL of DNA template in a Qubit 4 Fluorometer and with the 1X dsDNA High Sensitivity (HS) assay Kit (Thermo Fisher Scientific, Inc.). DNA extraction concentration ranged from 0.001–7.20 ng/µL (mean = 0.943 ng/µL).

Prior to library preparation, 1–50 ng of DNA template was sheared to an average fragment length of 300–600 bp using a Qsonica Q800R2 Sonicator (Qsonica LLC, Newton, CT, U.S.A.) for 60 s with amplitude set at 25 and the pulse set at 10. Libraries were prepared on 96-well plates on a DynaMag™-96 side magnet (Invitrogen, Thermo Fischer Scientific, Waltham, MA, U.S.A.) and using the Kapa Hyper Prep Library Kit (Roche Diagnostics Corporation, Indianapolis, IN, U.S.A.) as described in Faircloth et al. (2015) with the iTru Adapter protocol. We implemented all magnetic bead clean-up steps (Fisher et al. 2011) as described in Faircloth et al. (2015) and used dual-indexing TruSeq adapters (Faircloth and Glenn 2012, Glenn et al. 2019) for ligation. The ligation step was followed by PCR-amplification of 15 µL of the library product using 25 µL of KAPA HiFi ReadyMix (Roche Diagnostics Corporation, Indianapolis, IN, U.S.A.), 2.5 µL of each of Illumina TruSeq (i5 and i7) primers, and 5 µL nuclease-free ddH₂O. The following thermal cycler program was executed: 98 °C for 45 s; 13 cycles of 98 °C for 15 s, 60 °C for 30 s, 72 °C for 60 s; and final extension at 72 °C for 5 m. Following PCR, we purified DNA products using 1.1× Kapa Pure beads and rehydrated the purified product in 22 µL of Elution Buffer (pH = 8). Individual libraries were quantified using 2 µL of library product in a Qubit 4 Fluorometer using the 1X dsDNA Broad Range (BR) assay Kit (Thermo Fisher Scientific, Inc.). Post-PCR libraries have concentrations ranging from 3.05–114.9 ng/µL.

Post-PCR libraries were pooled at equimolar concentrations into 25 pools, each containing 6–12 libraries. Pool concentration was adjusted to ~71.5 ng/µL by drying the sample in a vacuum centrifuge for 45–60 min or until all liquid was evaporated at 60 °C, and then by re-suspending the pool in nuclease-free water at the estimated volume. We then used 2 µL of the resuspended product to measure the pool final concentration in a Qubit 4 Fluorometer with the 1X dsDNA BR assay Kit. The final concentration of the pre-enrichment pools was 63.6–91.4 ng/µL. The pool was enriched by using the myBaits (Arbor Biosciences, Ann Harbor, MI, U.S.A.) UCE Hymenoptera bait set (“Hymenoptera 2.5Kv2P”) targeting 2590 conserved loci in Hymenoptera (Branstetter et al. 2017) at an incubation temperature of 65 °C for 24 h in a thermal cycler. Enrichment, bead-cleaning, and PCR reaction procedures partially followed the Arbor Biosciences v5.0.1 (https://arborbiosci.com/mybaits-manual/) protocol and Branstetter et al. (2021) and Hanisch et al. (2022). The resulting reaction was purified using 1.0X Kapa Pure beads (Roche Diagnostics Corporation, Indianapolis, IN, U.S.A.) and the enriched pool was then rehydrated in 22 µL elution buffer. The final two enriched pools were submitted to Admera Health Biopharma Services (NJ, U.S.A.) for quality control and sequencing of two lanes on an Illumina HiSeq2500 instrument. A summary of the raw data, contigs, UCE loci recovered, and other assembly statistics for each sample is presented in Suppl. material 1: table S2. Most extractions and UCE laboratory work were conducted in the Laboratories of Analytical Biology (LAB) facilities of the National Museum of Natural History, Smithsonian Institution. New raw sequences generated as part of this study are deposited in the NCBI Sequence Read Archive (SRA) under BioProject number PRJNA1088885 and under accession No. SAMN40504884–SAMN40505120.

We trimmed the demultiplexed FASTQ output files for adapter contamination and low-quality bases using Illumiprocessor v.2.0.6 (Faircloth 2013, modified by R. Dikow and P. Frandsen to use trim_galore v0.4.1 (Krueger 2015)). We used SPAdes v.3.14 (Bankvich et al. 2012, Nurk et al. 2013) to assemble the clean reads into contigs. We used a series of scripts available in the PHYLUCE package (Faircloth 2016) to further process our data and we followed the methods used in Barrera et al. (2022), Hanisch et al. (2022), Blaimer et al. (2023). We aligned each UCE locus using MAFFT v7.407 (Katoh and Standley 2013) using the default algorithm. The alignment step was repeated using the L-INS-I algorithm in MAFFT, which tends to generate more accurate alignments (Katoh et al. 2005, Katoh and Standley 2014). We trimmed poorly aligned regions in each UCE locus with GBLOCKS (Castresana 2000, Talavera and Castresana 2007) using relaxed settings (b1 = 0.5, b2 = 0.5, b3 = 12, b4 = 7). Initial alignments were generated by first aligning individual UCE loci with different percentage of taxon representation, thus 50% (119 taxa, 1,477 loci), 60% (143 taxa, 1,379 loci) and 70% (166 taxa, 1,211 loci) using the PHYLUCE script phyluce_align_get_only_ loci_with_min_taxa. We then concatenated those loci into a data matrix using the PHYLUCE script phyluce_align_format_nexus_files_for_raxml, named Ganasbra237t_50p, Ganasbra237t_60p, and Ganasbra237t_70p, respectively, for exploratory and downstream analyses.

Initial analyses were conducted on the unpartitioned three alignments generated (Ganasbra237t at 50%, 60%, and 70%, respectively) using IQ-TREE multicore v.2.1.3 (Minh et al. 2020), the GTR+F+G4 model of evolution (as selected by IQ-TREE), the default number of unsuccessful iterations to stop (-nstop 100), and an initial neighbor-joining tree (-t BIONJ). Node support was estimated by conducting 1,000 ultrafast bootstraps (UFBoot) (Hoang et al. 2018).

To identify and remove outlier or poorly aligned sequence fragments we used the Python tool SPRUCEUP (Borowiec 2019) on the Ganasbra237t_60p alignment. Parameters in the configuration file were set up to the uncorrected p-distance for computing the distances, window size = 20 bp and overlap = 15 bp, a lognormal distribution to identify outlier distances, and a global cutoff of 0.997. As a result, SPRUCEUP removed 56,045 (0.02%) outlier nucleotide-site state assignments (i.e., matrix cell values (Suppl. material 1: table S3). We then used the resulting SPRUCEUP-trimmed alignment and repeated the unpartitioned analysis using the same parameters as above, including 1,000 replicates of the SH-like approximation likelihood-ratio test (-alrt 1000) (Guindon et al. 2010). Upon inspection of the resulting tree and the png files generated by SPRUCEUP, additional, manual cutoffs were performed for 23 taxa (see Suppl. material 1: table S3 for cutoff values).

We partitioned the resulting trimmed alignment using the Sliding Window Site Characteristics based in Entropy method (SWSC-EN; Tagliacollo and Lanfear 2018), in which each UCE locus is divided into three regions (a core and two flanking regions). The SWSC-EN algorithm identified 4,137 subsets. We then identified the best partitioning scheme by merging the resulting subsets using ModelFinder (Kalyaanamoorthy et al. 2017) as implemented in IQ-TREE (Minh et al. 2020). For the merging step, we used the -m MF+MERGE command, the fast relaxed -rclusterf algorithm (set to 10; Lanfear et al. 2017) and compared the top 10% of the resulting partitioning schemes using the corrected Akaike information criterion (AICc), restricting the evaluated models to those implemented in RAxML by using the command -mset raxml. The best-fit partitioning scheme (0.997_lognorm_man_Ganasbra237t_60p_SWSCEN) consisted of 1,629 partitions.

We tested for model violation based on assumptions of stationarity and homogeneity by performing a test of symmetry (Naser-Khdour et al. 2019) as implemented in IQ-TREE 2.1.3 (Chernomor et al. 2016; Minh et al. 2020) on the partitioned dataset above. We removed bad partitions by using the –symtest-remove-bad option with a P-value cutoff set as the default (P = 0.05). The test of symmetry identified and removed 536 out of the 4,137 subsets generated by SWSC-EN. The resulting best-fit partitioning scheme (0.997_lognorms_cutoff_man_Ganaspis237 -60p_partitions.nex.good_SYMTEST) consisted of 1,422 partitions.

We performed further maximum-likelihood (ML) analyses on the trimmed alignment with the different partitioning schemes using IQ-TREE multicore v.2.1.3 (Chernomor et al. 2016; Minh et al. 2020), estimating branch support with the ultrafast bootstrap (Hoang et al. 2018) and the SH-like approximation likelihood ratio test (Guindon et al. 2010) set at 1,000 replicates, with other settings set at default values on the 0.997_lognorms_cutoff_man_Ganaspis237-60p_partitions.nex. good_SYMTEST alignment. Statistics for all the data matrices generated for this study are summarized in Suppl. material 1: table S4 and all trees generated for this study are in supplementary information (https://figshare.com/s/93d692506c0fe68a7ddd).

We employed the species delimitation plugin v.1.4.5 (Masters et al. 2011) in Geneious Prime (www.biomatters.com) to summarize the average pairwise tree distance (using the tree in Fig. 6) among members of a clade (Intra Dist) and the average pairwise tree distance among a clade and its closest clade (Inter Dist). Results are summarized in Table 1 and Suppl. material 1: table S5.

Employing the Phyluce script phyluce_assembly_match_contigs_to_barcode and a COI sequence as reference (‘Ganaspis brasiliensis’ downloaded from GenBank accession No. MN013168.1), we extracted from the UCE data bycatch (Ströher et al. 2017) the cytochrome oxidase I (COI) gene fragment for a subset of samples, including from a non-type specimen of the original description of Ganaspis brasiliensis not included in the UCE data analyses above. The contig.slice files were then inspected in Geneious Prime v.2024.0.4 (www.biomatters.com) and mapped to the reference sequence (MN013168.1) using the BBMap v.1.0 (Bushnell 2014) plugin. COI sequences, of some specimens, are given at the end of the description of each species, and they have also been deposited in GenBank under accession No. PP599368–PP599375 (see Suppl. material 1: table S6).

In average, we recovered 1,369 UCE loci (range: 672–1,670) with a mean length of 878 bp (range: 341–1,801 bp). The final alignment included 237 terminals, 1,379 UCE loci, and 1,221,982 bp of sequence data, of which 523,179 were parsimony-informative sites. The alignment was composed mostly of samples in the genus Ganaspis and two samples belonging to the genus Leptopilina Föster, 1862, as a distant outgroup. The test of symmetry conducted in IQTREE 2.1.3 (Chernomor et al. 2016; Minh et al. 2020) identified and removed 536 and 565 bad partitions depending on the SPRUCEUP manual cut-off employed (Suppl. material 1: table S3). The resulting ‘good’ alignments consisted of 964,889 and 960,213 bp of sequence data and 427,640 and 427,499, respectively. For additional assembly and additional statistics, see Suppl. material 1: table S4. All trees generated in this study are deposited in supplemental information (https://figshare.com/s/93d692506c0fe68a7ddd).

Morphological examination of the scutellum and ovipositor revealed subtle but consistent differences among specimens examined (Fig. 3). For the scutellum, the lateral aspects were carinate/striate in tropical specimens (G. brasiliensis), but totally smooth in more temperate specimens (G. kimorum, G. lupini). Further, members of G. kimorum were discovered to have a reduced ovipositor clip (Fig. 4). Research on the genome (Hopper et al. 2024), host specificity (Girod et al. 2018b; Wang et al. 2018; Seehausen et al. 2020; Daane et al. 2021), reproductive isolation (Seehausen et al. 2020; Hopper et al. 2024), and DNA barcode region (Nomano et al. 2017) are consistent with the morphological characters and UCE phylogenomic data shown here (Fig. 6). Together these data support the description of G. kimorum and G. lupini as species new to science. Fig. 6 shows the phylogram of these species; major sources of specimens are highlighted. Table 1 summarizes the various lines of study for species delimitation.

Ganaspis brasiliensis species group

Included species. Ganaspis brasiliensis (Ihering, 1905); Ganaspis kimorum sp. nov.; Ganaspis lupini sp. nov.

Diagnosis. Scutellum large, terminating anterior to the end of the scutellum; convex in lateral view, bulging slightly. Marginal cell closed in forewing. Posterior edge of metapleuron uninterrupted. Segments of female antennal clava very moderately enlarged and concolorous with other flagellomeres (Buffington and Forshage 2016). In the Ganaspis brasiliensis species group, the plate covers at least half of the scutellum, when viewed dorsally; in lateral view, the scutellar plate is clearly convex, even bulging, anterior to the glandular release pit. In other Ganaspis species, the scutellar plate may be as large or smaller, covering less than half of the scutellum when viewed dorsally; the plate, in lateral view, is flat or gently convex, and if large, not bulging. The marginal cell and claval characters are quite variable in other Ganaspis species.

Description. Coloration with head, mesosoma, and metasoma black to dark brown; legs uniformly light brown. Sculpture on vertex, lateral surface of pronotum, mesosoma, and metasoma absent, surface entirely smooth (Fig. 1). Length 1.5–1.75 mm.

Figure 1. 

Type-specimens of the species belonging to the G. brasiliensis species complex A brasiliensis, lectotype B kimorum, holotype C lupini, holotype.

Head. In anterior view, rounded, approximately as high as broad; in lateral view, more transverse, not protruding. Pubescence on head sparse, nearly glabrous. Sculpture along lateral margin of occiput absent (Fig. 2A). Gena (measured from compound eye to posterolateral margin of head) short, ratio of length of gena to length of compound eye in dorsal view <0.3 mm. Sculpture of gena absent, smooth. Lateral margin of occiput evenly rounded, not well defined (Fig. 2A). Occiput (except extreme lateral margin) smooth. Carina issuing from lateral margin of postocciput absent. Ocelli small, ratio of maximum diameter of a lateral ocellus to shortest distance between lateral ocelli 0.2–0.4 mm. Anterior ocellus far from posterior ocelli, clearly anterior to anterior margins of posterior ocelli. Relative position of antennal sockets close to ocelli, ratio of vertical distance between inner margin of antennal foramen and ventral margin of clypeus to vertical distance between anterior ocellus and antennal rim <2.0. Median keel of face absent. Vertical carina adjacent to ventral margin of antennal socket absent. Facial sculpture absent, surface smooth. Facial impression absent, face flat. Antennal scrobe absent. Anterior tentorial pits small. Longitudinal axis of posterior tentorial pits oblique. Vertical delineations on lower face absent. Ventral clypeal margin laterally, close to anterior mandibular articulation, straight. Ventral clypeal margin medially straight, not projecting. Clypeus smooth, evenly rounded. Malar space adjacent to anterior articulation of mandible evenly rounded, smooth. Malar sulcus present. Eye close to ocelli, ratio of distance between compound eye and posterior mandibular articulation to distance between posterior ocellus and compound eye >1.2 mm. Compound eyes, in dorsal view, distinctly protruding from the surface of the head, particularly laterally. Pubescence on compound eyes absent. Orbital furrows absent. Lateral frontal carina of face absent. Dorsal aspect of vertex smooth. Posterior aspect of vertex smooth. Hair punctures on lateral aspect of vertex absent. Posterior surface of head deeply impressed around post-occiput.

Figure 2. 

External anatomy of Ganaspis kimorum, a member of the Ganaspis brasiliensis species complex A head and mesosoma, lateral view B head and mesosoma, dorsal view C femal antennae D metapectal-propodeal complex, lateral view E fore- and hindwings, female F propodeum, dorso-lateral view.

Labial-maxillary complex. Apical segment of maxillary palp with pubescence, consisting only of erect setae. First segment of labial palp shorter than apical segment. Labial palp composed of two segments. Apical seta on apical segment of maxillary palp longer than twice length of second longest apical seta. Erect setae medially on apical segment of maxillary palp absent. Maxillary palp composed of four segments. Last two segments of maxillary palp (in normal repose) curved inwards. Distal margin of subapical segment of maxillary palp slanting inwards, apical segment bending inwards. Apical segment of maxillary palp more than 1.5× as long as preceding segment.

Antenna. Articulation between flagellomeres in antenna moniliform, segments distinctly separated by narrow neck-like articulation (Fig. 2C). Female antenna composed of 11 flagellomeres (Fig. 2C). Male antenna composed of 13 flagellomeres. Female F1 longer than F2. Flagellomeres of female antenna cylindrical, gently widened towards apex, slightly clavate (Fig. 2C). Placoidal sensilla present on F6-11 (Fig. 2C). Second flagellomere of male antenna cylindrical. Length of second flagellomere of male antenna equal to length of first flagellomere. Last antennal flagellomeres of female antenna not conspicuously enlarged compared to adjacent flagellomeres (Fig. 2C).

Mesosoma. Macrosculpture on lateral surface of pronotum absent (Fig. 2A). Anteroventral inflection of pronotum narrow. Pubescence on lateral surface of pronotum present, sparse, consisting of few short hairs posterior to setal trench (Fig. 2A). Anterior flange of pronotal plate subvertical, protruding, transversely strigate. Ridges extending posteriorly from lateral margin of pronotal plate absent (Fig. 2A). Lateral pronotal carina absent. Crest of pronotal plate absent. Dorsal margin of pronotal plate (in anterior view) straight; rounded. Submedian pronotal depressions open laterally, deep. Lateral margin of pronotal plate defined all the way to the dorsal margin of the pronotum. Width of pronotal plate narrow, not nearly as wide as head (Fig. 2B). Mesoscutal surface convex, evenly curved (Fig. 2A). Sculpture on mesoscutum absent, entire surface smooth, shiny (Fig. 2B). Notauli absent. Median mesoscutal carina absent. Anterior admedial lines absent. Median mesoscutal impression absent. Parascutal carina nearly straight anteriorly, posteriorly curved mesally. Mesopleuron entirely smooth (Fig. 2A). Subpleuron entirely smooth, glabrous (Fig. 2A). Lower pleuron entirely smooth, glabrous. Epicnemial carina absent. Lateroventral mesopleural carina present, marking abrupt change of slope of mesopectus (Fig. 2A). Mesopleural triangle present, slightly impressed without distinct ventral border (Fig. 2A). Subalar pit absent, subalar groove indistinct. Speculum absent. Mesopleural carina present, complete, composed of one complete, uninterrupted carina (Fig. 2A). Anterior end of mesopleural carina inserting above notch in anterior margin of mesopleuron. Dorsal surface of scutellum foveate-areolate (Figs 2B, 3). Circumscutellar carina absent (Fig. 3). Posterior margin of axillula marked by distinct ledge, axillula distinctly impressed adjacent to ledge (Fig. 3 A, C, E). Latero-ventral margin of scutellum posterior to auricula entirely smooth (Fig. 3A, C, E). Dorsoposterior part of scutellum rounded (Fig. 3A, C, E). Transverse median carina on scutellar plate absent. Dorsal part of scutellum entirely foveate. Scutellar plate large, widest in anterior half, covering most of scutellum; dorsally smooth, polished; glandular release pit at posterior end (Fig. 3B, D, F); in lateral view, often with an anterior hump, sunken around release pit, slightly upturned along posterior margin (Fig. 3A, C, E). Scutellar fovea present, two, distinctly margined posteriorly (Fig. 3B, D, F). Single longitudinal carina separating scutellar foveae present, short, ending at posterior margin of foveae (Fig. 3B, D, F). Longitudinal scutellar carinae absent. Postero-lateral margin of scutellum rounded. Lateral bar weakly strigate, narrow.

Figure 3. 

Comparison of the scutellar morphology between G. brasiliensis (A, B), G. lupini (C, D) and G. kimorum (E, F). Black arrows indicate sculptured (A) and smooth (C, E) lateral aspect of scutellum.

Metapectal-propodeal complex. Metapectal cavity anterodorsal to metacoxal base present, well-defined (Fig. 2D). Anterior margin of metapectal-propodeal complex meeting mesopleuron at same level at point corresponding to anterior end of metapleural carina. Posteroventral corner of metapleuron (in lateral view) rounded, not drawn out posteriorly (Fig. 2D). Anterior impression of metepimeron absent. Posterior margin of metepimeron distinct, with median part slightly depressed, not forming circular incision, separating metepimeron from propodeum (Fig. 2D). Subalar area slightly broadened anteriorly, with distinct laterally protruding lobe ventrally. Prespiracular process present, blunt, lobe-like, polished (Fig. 2D). Dorsellum present, smooth, glabrous. Anterior impression of metepisternum, immediately beneath anterior end of metapleural carina, absent. Pubescence not extremely dense on posterior part of metapectal-propodeal complex (Fig. 2D). Propodeal spurs absent (Fig. 2D). Lateral propodeal carinae present, elongate, projecting beyond metanotum to reach scutellum (Fig. 2D). Ventral end of lateral propodeal carina reaching nucha, carinae separated from each other. Inter propodeal carinae space lightly setose, smooth. Petiolar rim of uniform width along entire circumference. Petiolar foramen removed from metacoxae, directed posteriorly. Horizontal carina running anteriorly from lateral propodeal carina present. Lateral propodeal carina uniformly curved inward. Calyptra, in lateral view, rounded. Propodeum relatively short, not drawn out posteriorly (Fig. 2D). Calyptra, in posterior view, rounded.

Legs. Pubescence posterolaterally on metacoxa with a confined, elongate, dense hair patch, other pubescence lacking. Microsculpture on hind coxa absent (Fig. 2A). Longitudinal ridge on the posterior surface of metatibia absent. Metafemoral tooth absent. Distal mesotibial spurs shorter than medial spurs. Distal metatibial spurs shorter than medial spurs. Ratio of first metatarsal segment to remaining 4 segments <1.0. Pubescence on outer surface of metatarsal claw sparse, consisting of few setae. Outer surface of metatarsal claw almost entirely smooth. Base of metatarsal claw lammelate, with translucent cuticular flange.

Wings. Pubescence of fore wing present, long, dense on most of surface (Fig. 2E). Apical margin of female fore wing rounded. Rs+M of forewing completely defined (Fig. 2E). Vein R1 tubular along at least basal part of anterior margin of marginal cell. Mesal end of Rs+M vein situated closer to posterior margin of wing, directed towards posterior end of basalis (Fig. 2E). Basal abscissa of R1 (the abscissa between 2r and the wing margin) of fore wing as broad as adjacent wing veins. Coloration of wing absent, entire wing hyaline (Fig. 2E). Marginal cell of fore wing membranous. Areolet absent. Hair fringe along apical margin of fore wing present, very short.

Metasoma. Petiole about as long as wide. Surface of petiole dorsally striate, laterally shagreen. Posterior part of female petiole not abruptly widened. Ventral flange of annulus of female petiole absent. Ventral and lateral parts of petiolar rim narrow. Setal band (hairy ring) at base of tergum 3 present, complete dorsally, extending ventrally to ventral margin of tergum, beneath petiole. Tergum 3 indistinct, fused with syntergum. Posterior margin of tergum 3 indistinct, fused with tergum 4 in syntergum. Posterior margin of tergum 4 evenly rounded. Sternum 3 encompassed by syntergum. Sculpture on metasomal terga absent. Syntergum present with terga 3 to 5 fused, ventral margin rounded. Annulus present as continuous ring. Peglike setae on T6–T7 absent. Postero-ventral cavities of female metasoma T7 absent. Female postero-ventral margin of T6–T7 straight, parallel, with distinct postero-ventral setal tuft. Terebrum and hypopygium (in lateral view) straight, pointing posteriorly. Ovipositor clip present.

 Ganaspis brasiliensis (Ihering, 1905)

Figs 1A, 3A, B, 4A

Diagnosis

Separated from G. kimorum and G. lupini by the sculpturing on the side of the scutellum. In G. brasiliensis, this area has distinct dorso-ventral carinae enclosing one or a few cells (Fig. 3A). In G. kimorum and G. lupini, this area is totally smooth (arrows, Fig. 3C, E). Further separated from G. kimorum by the well-developed ovipositor clip that is expanded across more the half the width of the ovipositor valve (Fig. 4A).

Figure 4. 

Comparison of the ovipositor clip between G. lupini (A, C) and G. kimorum (B, D). A G. lupini ovipositor tip, lateral view B G. kimorum, ovipositor tip, lateral view C G. lupini ventral of ovipositor showing ovipositor clip and membrane D G. kimorum ventral of ovipositor showing ovipositor clip and membrane. Black arrows indicate the location of the ovipositor clip.

Redescription

As in the description for the G. brasiliensis species complex, but lateral aspect of pronotum with distinct ridge with associated fovea; ovipositor clip large, extending beyond the halfway point across the fused ovipositor valve. Previous studies referencing ‘Gb G5’ or ‘G5’, refer to this species (Nomano et al. 2017).

Material examined

Lectotype (female): Collection Ashmead [first label]; Ipiranga, Brazil [second label]; No 2066 from a peach [third label]; S.S. Paulo Museum 190 [third label]; Lectotype [fourth label, red, Weld’s hand]; Ipiranga, S.S. Paulo Museum 190, No. 4066a, on peach [folded hand-written label]; EUCOILIDAE, Pseudeucoila (Hexamerocera) brasiliensis Ashmead [white computer generated label]; USNMENT0119750. Deposited in USNM. Paralectotype (male): Collection Ashmead [first label]; Hexamerocera brasiliensis male/female symbol Ashm (over) [front side, second label] ex Drosophila punctata fruitfly [back side, second label]; Paratype [third label, red]; Eucoila (Hexamerocera) brasiliensis Ihering [fourth label, in Weld’s hand]; Pseudeucoila brasiliensis (R.v. Ihr.) [fifth label, Weld’s hand); EUCOILIDAE Eucoila brasiliensis [white computer generated label]; USNMENT01119745. Deposited in USNM.

Other material examined

Panama: Monte Oscuro, June-July ’95 [1895] Z-5203, USNMENT01119746 (male); USNMENT01119747 (female); Panama City, Z-3661 [no date]; 2 male specimens/ pin: USNMENT01119748–USNMENT01119749, USNMENT01119740–USNMENT01119742; Canal Zone, Balboa, VI.10.1936, J Zetek, collector, P.R. no. 1803; 4 females: USNMENT01119645–USNMENT01119648; 3 males: USNMENT01119649, USNMENT01119743, USNMENT01119744; Monte Oscuro, Panama City, Z-3666 [no date]; 1 female: USNMENT01119650; Monte Oscuro, Panama City, Z-3665 [no date]; 1 female: USNMENT01119651; Monte Oscuro, Panama City, Z-3665, ex Anastrepha acidusa, emerge 2–3 weeks after last fly out-25 days after pupation [no date]; 1 female: USNMENT01119652; Ancon, Canal Zone, Z-2748, Ex Anastrepha fratercula or Drosophila striata, July 1927, I. Molino, collector; 2 females: USNMENT01119653 and USNMENT01119654; Taboga Island, Sept. 30, 1926, I. Molino, collector, Z-2727; 11 females: USNMENT01119656–USNMENT01119665, 1male: USNMENT01119666; Panama City, Z-3222, Ex Anastrepha serpentina in nispero, May 1930, J Zetek, collector; 2 males: USNMENT01119667, USNMENT01119668; Ancon, Canal Zone, Z-2715, Oct. 12, 1926, bred by Molina, ex fruit of Spondias lutea, parasite of diptera Z-2716; 1 female: USNMENT01119669. Guadeloupe: Ganaspis G. 302.1, Y. Carton; 3 females: USNMENT01119670–USNMENT01119672; 3 males USNMENT01119673–USNMENT01119675.

Cytochrome c oxidase subunit I (COI) Barcode region

> Pseudoeucoila_brasiliensis_AP7BC36 (USNMENT01119647)

NNNNNNNNNNNNNNNNNNNNNAATTTGATCAGGAATAATTGGATCAAGTTTAAGAATAATTATTCGTCTA GAATTAGGCACCCCTTCACAATTAATTAATAATGATCAAATTTATAATACAATTGTTACCACTCATGC ATTTGTAATAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTACTTAATTCCCT TAATATTATCTGCCCCTGATATATCATTTCCTCGTCTTAATAATATAAGATTCTGATTATTAATTCCT TCTTTAATTTTAATAATTTCAAGTATATTTATTGATGAAGGATCTGGAACCGGATGAACCATTTATCC TCCTTTATCATTAAATAAATCACATCCAGGAATTTCAACTGATTTAGTAATTTTCTCCCTTCATCTTA GAGGAATTTCTTCAATTTTAGGATCAATTAATTTTATTACAACTATTTTAAATATACGACCTAATTTT ATAAGTATAGATAAAATTTCTTTATTTACTTGATCCATTTTTCTTACTACCATTTTATTATTATTATC TTTACCAGTATTAGCAGGCGGAATCACTATATTATTATTTGACCGAAACATTAATACATCTTTTTATG ACCCAATAGGAGGAGGTGATCCTATTC

>Ganaspis_brasiliensis_2966

TATATTATATTTTATTTTTGGAATTTGATCAGGAATAATTGGATCAAGTTTAAGAATAATTATTCGACTAGAAT TAGGCACCCCTTCACAATTAATTAATAATGATCAAATTTATAATACAATTGTTACCACTCATGCATTTGTAA TAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTACTTAATTCCTTTAATATTATCTG CCCCTGATATATCATTTCCTCGTCTTAATAATATAAGATTCTGATTATTAATCCCTTCTTTAATTTTAATAA TTTCAAGTATATTTATTGATGAAGGATCTGGAACAGGATGAACAGTTTATCCTCCTTTATCATTAAATAAAT CACATCCAGGAATTTCAACTGATTTAGTAATTTTCTCCCTTCATCTTAGAGGAATCTCTTCAATTCTAGGAT CAATTAATTTTATTACAACTATTTTAAATATACGACCTAATTTTATAAGTATAGATAAAATTTCTTTATTTA CTTGATCTATTTTTCTTACTACCATTTTACTATTATTATCTTTACCAGTATTAGCAGGTGGAATCACTATAT TACTGTTTGATCGAAACATTAATACATCTTTTTATGATCCAATAGGAGGAGGTGACCCTATTCTATACCAAC ATTTATTC

>Ganaspis_brasiliensis_2919

TATATTATATTTTATTTTTGGAATTTGATCAGGAATAATTGGATCAAGTTTAAGAATAATTATTCGACTAGAA TTAGGCACCCCTTCACAATTAATTAATAATGATCAAATTTATAATACAATTGTTACCACTCATGCATTTGT AATAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTACTTAATTCCTTTAATATTAT CTGCCCCTGATATATCATTTCCTCGTCTTAATAATATAAGATTCTGATTATTAATCCCTTCTTTAATTTTA ATAATTTCAAGTATATTTATTGATGAAGGATCTGGAACAGGATGAACAGTTTATCCTCCTTTATCATTAAA TAAATCACATCCAGGAATTTCAACTGATTTAGTAATTTTCTCCCTTCATCTTAGAGGAATCTCTTCAATTC TAGGATCAATTAATTTTATTACAACTATTTTAAATATACGACCTAATTTTATAAGTATAGATAAAATTTCT TTATTTACTTGATCTATTTTTCTTACTACCATTTTACTATTATTATCTTTACCAGTATTAGCAGGTGGAAT CACTATATTACTGTTTGATCGAAACATTAATACATCTTTTTATGATCCAATAGGAGGAGGTGACCCTATTC TATACCAACATTTATTC

Biology

Kionobiont endoparasitoid of Drosophila melanogaster, D. simulans, and other Drosophila in decaying fruit. Original description and some label data suggesting Anastrepha (Tephritidae) as a host are most likely to represent erroneous associations (cf. Buffington and Forshage 2016).