Research Article |
Jonathan Vogel‡, Mattias Forshage§, Saskia B. Bartsch‡, Anne Ankermann‡, Christoph Mayer‡, Pia von Falkenhausen‡, Vera Rduch‡, Björn Müller‡, Christoph Braun‡, Hans-Joachim Krammer‡, Ralph S. Peters‡
|
Corresponding author: Jonathan Vogel ( jvogel.hym@gmail.com ) Academic editor: Miles Zhang
© 2024 Jonathan Vogel, Mattias Forshage, Saskia B. Bartsch, Anne Ankermann, Christoph Mayer, Pia von Falkenhausen, Vera Rduch, Björn Müller, Christoph Braun, Hans-Joachim Krammer, Ralph S. Peters.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Vogel J, Forshage M, Bartsch SB, Ankermann A, Mayer C, von Falkenhausen P, Rduch V, Müller B, Braun C, Krammer H-J, Peters RS (2024) Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species. Journal of Hymenoptera Research 97: 621-698. https://doi.org/10.3897/jhr.97.131350
|
 |
Abstract
The genus Anacharis Dalman, 1823 comprises parasitoid wasps that target early instars of brown lacewing larvae (Neuroptera: Hemerobiidae). So far, five species were recognised from the Western Palaearctic region, of which four are reported from Northwestern Europe.
In this study, we address the Northwestern European species diversity of the genus with an extended integrative taxonomy toolkit. A total of 700 specimens were examined for their external morphology, including the relevant type specimens. For 354 specimens, we obtained CO1 barcode sequences and applied three molecular species delimitation methods. All DNA barcode data are made publicly available via the German Barcode of Life (GBOL) and Barcode of Life Data system (BOLD) database. In addition, we examined images of Wing Interference Patterns (WIPs), examined the male genitalia and performed multivariate morphometric analyses.
The analyses revealed two clusters which we describe as the immunis and eucharioides species groups based on differences in DNA barcode, external morphology, WIPs and size of the male genitalia. Furthermore, we complement the diagnosis of the genus Anacharis and describe three new species, Anacharis martinae Vogel, Forshage & Peters, sp. nov., Anacharis maxima Vogel, Forshage & Peters, sp. nov. and Anacharis minima Vogel, Forshage & Peters, sp. nov. Finally, we synonymise A. fergussoni Mata-Casanova & Pujade-Villar, 2018, syn. nov. with A. eucharioides (Dalman, 1818), and we reinstate A. ensifer Walker, 1835, stat. rev., A. typica Walker, 1835, stat. rev. and A. petiolata Zetterstedt, 1838, stat. rev. as valid species. In total, we recognise nine Northwestern European species to which we provide an identification key.
The species of Anacharis are morphologically very variable. Morphometric analyses alone did not provide information sufficient to delimit species, neither did analyses of WIPs and male genitalia, with few notable exceptions. Analyses of molecular sequence data proved crucially helpful to reliably delimit species and to find morphological diagnostic characters in a reverse taxonomy approach. For delimiting species groups, all included analyses proved helpful, and we show that exploring an extended integrative taxonomy toolkit can be beneficial for a comprehensive characterisation of species. We acknowledge that a complete overview of species distributions, and characterisation of ecological niches & host records is still required to deeply understand the genus as a whole, yet our results already allow broad access to and inclusion of Anacharis species in downstream biodiversity research.
Keywords
CO1 barcoding, integrative taxonomy, male genitalia, morphometrics, Western Palaearctic, WIPs
Introduction
Anacharis Dalman, 1823 (Figitidae: Anacharitinae) is a genus of parasitoid wasps that target early instar larvae of brown lacewings (Neuroptera: Hemerobiidae) as hosts. Specimens of the genus Anacharis can be quite common in Malaise trap or sweep net samples and are clearly the most common representatives of Anacharitinae in the Western Palaearctic region. They are typically found on or near vegetation in various habitats (herbs, shrubs, canopy of deciduous and coniferous trees) in which their hosts occur (
Until recently, only two species were recognised as valid for the Western Palaearctic region: A. eucharioides (Dalman, 1818) and A. immunis Walker, 1835, with a large number of names regarded as junior-synonyms of either of the two (
In this study, we re-target the Northwestern European fauna of Anacharis by examining several hundred specimens, including relevant type specimens. For the first time for this genus we analyse CO1 barcode data in addition to examination of external morphology, and also include analyses of wing interference patterns, examination of dissected male genitalia and multivariate morphometrics. We aimed to characterise the species present in the study region but also to explore an extended integrative taxonomy toolkit in this challenging parasitoid wasp taxon, following the principle of a unified species concept as described by
We generated high quality DNA barcode data in the framework of the GBOL III: Dark Taxa project (
The first character we explored in addition to morphological examination and analyses of DNA barcodes, are Wing Interference Patterns (WIPs), which are a property of insect wings. Especially wings of smaller insects show a remarkable array of colourful patterns on their wing membranes if the lighting conditions are right. The differences in colour and extent of each pattern is largely determined by the thickness and texture of the wings.
Little is known about the function of WIPs and their role might vary from group to group. They are hypothesised to be used for communication with conspecifics in, for example, courtship and mating of Drosophila Fallén, 1823 (
The second character complex we explored here is the morphology of male genitalia. In recent years, the analysis of male genitalia of parasitoid wasps went through a renaissance. Studies made progress in describing genitalia morphology, facilitating comparison between various lineages, for example, Ceraphronoidea and Ichneumonoidea (
As a third line of enquiry, we explored multivariate analyses of morphometric characters. Morphometric characters and ratios are routinely applied by taxonomists to complement species’ diagnoses and descriptions (e.g.
With this study we contribute to a clearer picture of the diversity of the Northwestern European Anacharis species, their intraspecific morphological variability, and show the potential of still relatively unexplored character traits for their use in alpha-taxonomical studies. Moreover, we refine the diagnosis of the genus and diagnose two species groups. The results of this work convey the release of the currently most comprehensive and taxonomically evaluated CO1 DNA barcode sequence dataset of Anacharis worldwide.
Material and methods
Institutional abbreviations
ZMHB Museum für Naturkunde, Berlin, Germany
Specimens and identification
In total, we acquired 394 fresh ethanol-preserved specimens in the course of the German Barcode of Life project (GBOL III: Dark Taxa) (see Suppl. material
We cite the label information of the historical type specimens verbatim in congruence with the Example 1 of the Darwin Core term “verbatimLabel” (i.e. citing one label per line, with personal interpretations of ambiguous label contents in square brackets, see https://dwc.tdwg.org/examples/verbatimLabel for details). All other specimens are cited as recommended by the journal’s author guidelines and separated into 1. type material, 1.1 primary type specimen(s), 1.2 secondary type specimen(s) and 2. other material, 2.1 DNA barcode vouchers, 2.2 Material without DNA Barcode.
All specimens are deposited at the
For the vertical distribution of each species we only accounted for the specimens where either elevation, coordinates or both were given on the labels and are likely biased when extreme statements are made. Especially those statements about lowland preference are affected due to the Swiss specimens that usually lack this information.
Terminology
The terminology used herein follows
One character is newly defined here:
posteroventral hypocoxal furrow = The posteroventral groove of the mesopleuron that is located just before the insertion of the mid coxa (e.g. Fig.
Imaging
For imaging of the specimens, we used a Canon EOS 7D® camera mounted on a P-51 Cam-Lift (Dun, Inc.). For lighting, we used a bidirectional flashlight arrangement set to medium intensity for habitus- and maximum intensity for detail-shots. We placed a sandwich paper-coated acrylic glass tube (ca. 6 cm diameter) around the specimen for light diffusion. The aperture was set as high as possible without underexposing the specimen. The image series were evaluated in ADOBE LIGHTROOM® v.5.6 and stacked with HELICON FOCUS® v.8.2.2.
For the SEM imaging, we mounted the heads of two specimens (Anacharis petiolata:
DNA sequencing and molecular species delimitation
We performed non-destructive full-body DNA extractions from our specimens at the Center for Molecular Biodiversity Research (ZMB) at the
Using IQ-TREE v2.2.2.6 (
Maximum likelihood tree based on DNA barcode data, constructed with IQ Tree. The results of the species delimitation analyses are summarised on the right. Black boxes indicate congruence with our morphological examinations, while the red boxes highlight disagreements. Species and species groups are named according to the results of our integrative taxonomy approach (see corresponding treatments). The dotted line is connecting the outgroup, Aegilips sp., to the remaining tree and is not to scale. Identical sequences from the same sites are combined in respective tip labels and are indicated with a (+ n). Ultrafast-bootstrap support is shown on the nodes.
For the molecular characterisation of species (see species treatments), we analysed the distance matrix from the alignment provided in GENEIOUS to extract maximum intraspecific distances and minimum interspecific distances, stating the name of the closest species in parentheses. The consensus sequence was generated by aligning the sequences of each species separately in GENEIOUS. For the molecular characterisation we only used the sequences of those specimens that we also studied morphologically, i.e. excluding the sequences downloaded from BOLD.
WIPs analysis
We performed all steps of a WIP preparation and imaging protocol for small ethanol-preserved insect (wasp) specimens (DOI: dx.doi.org/10.17504/protocols.io.bp2l6xyy1lqe/v1) published along with this manuscript. In short, the protocol covers instructions for the following steps:
Section 1 - Slide preparation
Descriptions of how to dissect the wings, get fore and hind wing centrally positioned on a microscopic slide for better standardisation and prepare the slide for long term storage in a natural history collection.
Section 2 - Imaging
Information on the camera system we used, the settings and how the raw images of the WIPs were acquired.
Section 3 - Image processing
All steps to manually adjust the image values to make the WIPs stand out (cf. Fig.
Fore and hind wings of different species of Anacharis showing the WIPs A A. ensifer stat. rev. male (
In this study, we applied the following specifications to the protocol:
We used an Olympus SZX12 for a first batch of 179 preparations and a Leica M205 C for stereo microscope for a second batch of 37 preparations.
The first 179 wing dissections were done prior to DNA lysis and the wings were kept in ethanol tubes until further processing.
As background for imaging the WIPs, we used a cardboard painted with “ultrablack” Musou black from KOYO Orient Japan Co., Ltd., which absorbs up to 99.4% of light (according to the manufacturer).
The steps of section 3 (image processing) were followed only for the WIPs images shown in Fig.
By publishing the protocol for wing preparation and WIPs imaging from ethanol-preserved (small) insect specimens, we tried to provide standardisation for the necessary steps, specifically to a) produce standardised, artifact-free and high-quality WIP images, b) secure long-term-storage of the specimens, c) make the prepared wings re-traceable to the specimens they have been taken from, d) secure reproducibility of the imaging even decades after preparation (i.e. easy cleaning of the wing specimens prior to imaging), and to e) allow reproduction of the protocol with minimal financial resources. In all these aspects, there is undeniably room for improvement, yet we deliberately published the protocol on protocols.io. All interested parties are thereby invited to contribute to an optimised protocol. This will allow integration of WIPs in further applications such as advanced statistical or machine learning methods aiming at automated species identification.
Male genitalia
We dissected the genitalia of 21 male specimens. The first 15 genitalia were extracted from metasomas that were dissected prior to the DNA lysis. The remaining six were extracted post-lysis without dissecting the entire metasoma. The genitalia were removed from the metasomas by fixating the metasomas with forceps and scooping out the genital with a minuten pin mounted on a skewer. In most cases, the apical half of the metasoma needed to be cut off as squeezing it did not let the genital capsule extrude. In those cases, we disintegrated the gaster to lay bare the genital. The “remaining” fragments of the gaster were discarded.
We used a Zeiss Axio Imager.Z2m. to produce multi-focus images that were later stacked with Helicon Focus v.8.2.2 (Helicon Soft Ltd.). For the genitalia shown in Fig.
Comparison of Anacharis male genitalia in ventral view A A. ensifer stat. rev. (
SEM images of the heads of Anacharis typica:
Morphometrics
Of a total of 115 specimens, consisting of 68 males and 47 females, we measured 48 external morphological characters. The selection of characters is mainly based on the measurements implemented in
Characters marked with asterisk were excluded from the morphometric analyses..
| Character | Orientation | Description |
|---|---|---|
| Head length | Lateral | Distance from below the toruli in a right angle to the vertical head axis until the posterior edge of the head |
| Head width | Frontal and dorsal | Longest distance between the outer delimitation of the eyes. |
| Head height | Frontal | Distance from ventral clypeal margin to top of ocellar triangle |
| Malar space length | Frontal | Shortest distance between most dorsal corner of mandibular base to the eye |
| Eye height | Frontal | Longest distance between ventral margin of eye and the eye dorsally |
| Eye-to-eye distance | Frontal | = transfacial line in |
| Torulus diameter | Frontal | Diameter of an individual torulus, either left or right |
| Toruli distance | Frontal | Shortest distance between the toruli |
| Torulus eye distance | Frontal | Shortest distance between torulus and eye, left or right |
| Post ocellar line (POL) | Dorsal | Shortest distance between margins of median ocellus and lateral ocellus, either left or right |
| Ocular ocellar line (OOL) | Dorsal | Shortests distance between margins of lateral ocellus, left or right, and eye |
| Lateral ocellar line (LOL) | Dorsal | Shortest distance between margins of lateral ocelli |
| Ocellar Diameter (OD) | Dorsal | Diameter of the median ocellus |
| Antenna length* | Lateral or dorsal, depending on the positioning of the antenna | Distance from basal margin of scape to the apex of the last antennomere, measured on left or right antenna; in some cases calculated from the sum of the individual segments, as the antennae were too strongly bent |
| Antennomere length* | Lateral or dorsal, depending on the positioning of the antenna, scape always measured in lateral view | Distance from the basal margin of an antennomere to its apex, measured medially on left or right antenna |
| Length of mesosoma | Lateral | Distance between most anterior point of pronotum to the most posterior point of the nucha |
| Mesoscutum length | Dorsal | Longest distance between anterior and posterior margin of the mesoscutum |
| Mesoscutum width | Dorsal | Longest distance between the lateral margins of the mesoscutum |
| Mesoscutellum length | Dorsal | Longest median distance from anterior to posterior margin of the mesoscutellum |
| Fore wing marginal cell length | Dorsal | Distance between transversal section of front wing vein R1 and the intersection of R1 and Rs |
| Fore wing marginal cell width | Dorsal | Shortest distance between intersection of vein r and Rs and the marginal section of vein R1 |
| Hind coxa length | Lateral | Longest distance between basal annular girdle and apical margin of the metacoxa |
| Length of metasoma* | Lateral | Longest distance between posterior margin of nucha and posterior margin of the 7th metasomal sternite |
| Petiole length | Lateral | Distance between anterior constriction of petiole to anterior margin of the 2nd metasomal tergite |
| Metasomal tergite 2 length* | Lateral | Longest median distance between anterior and posterior margin of the tergite |
| Metasomal tergite 2 length* | Dorsal | Longest median distance between anterior and posterior margin of the tergite |
| Metasomal tergite 3 length* | Lateral | Longest median distance between anterior and posterior margin of the tergite |
| Metasomal tergite 3 length* | Dorsal | Longest median distance between anterior and posterior margin of the tergite |
| Metasomal tergite 4 length* | Lateral | Longest median distance between anterior and posterior margin of the tergite |
| Metasomal tergite 4 length* | Dorsal | Longest median distance between anterior and posterior margin of the tergite |
| Male genital length* | Ventral | Median distance between the anterior parameral plate and the apex of the aedeagus |
| Male genital aedeagus width* | Ventral | Longest distance between lateral margins of the vertical penis valves |
For the measurements, a calibrated scale ocular on a Leica M205 C stereomicroscope was used. Of those specimens that lacked wings due to the preparation of WIPs images, the wing length & marginal cell dimensions were measured on the WIPs images digitally using GIMP. As many male metasomas were dissected and/or destroyed prior to the measurements, no metasomal measurements for those specimens could be obtained, except the petiole length in most cases. The complete raw data is attached in Suppl. material
We applied the imputation function of the mice R package (
We applied multivariate morphometric analysis based on
Results
Molecular analyses
We obtained the CO1 barcode sequences of 354 out of 394 specimens (90% success rate). 348 sequences had the full 658 bp DNA barcode length, 6 had shorter sequences with a minimum length of 645 bp.
The numbers of species suggested by the automated species delimitation approaches ranges from seven (spID with 97% similarity threshold and mPTP) to nine (ASAP) (Fig.
Two species groups are apparent from the analyses of the DNA barcode data (see also taxonomic section), with a minimum distance of 16%.
WIPs
In total, we prepared 186 images of WIPs (145 A. eucharioides, 14 A. norvegica, 9 A. martinae, 7 A. immunis, 6 A. typica, 4 A. maxima, 1 A. petiolata). We could not obtain any image for A. minima.
The WIPs exhibit the following general characteristics. The basal and marginal cell of the fore wing is largely pattern-free. The radial area (defined by wing margin, vein Rs, and the non-sclerotised vein M) has an absent to faint pattern of straight to curved purple bands that does not reach the wing apex. How close the band-pattern extends towards the wing apex varies slightly between species. The patterns on the median area (defined by the wing margin and the non-sclerotised veins Rs+M, M, Cu1 and Cu1a) vary inter- and intraspecifically.
The basal cell of the hind wing is pattern-free. The radial, medial and cubital areas are fused to an apical area (defined by vein R1, Rs&1r-m, its shortest distance to the wing’s hind margin and the wing margin). The pattern of the apical area consists of a spot that is situated at the apex of the wings which is surrounded by colour that does not follow an intraspecifically consistent pattern. The spot is running along the hind margin of the wing to an extent that varies between species groups. The dimensions, i.e. how much of the apical area is filled with the apical spot, partly varies between species (see descriptions of A. martinae sp. nov. and A. maxima sp. nov.). The basiocubital area (defined by the shortest distance of Rs&1r-m to the wing’s hind margin, M+Cu1 and the wing margin) is often pattern-free or shows variable patterns.
Male genitalia
The male genitalia of 21 specimens, representing all species except A. petiolata and A. minima, were dissected and measured. The post-DNA-lysis genitalia (Fig.
The overall shape of the genitalia of Anacharis is very similar between species (Fig.
The genitalia are 243–423 µm in length, with a distinct difference between the species groups (see treatment section below). We observe consistent species-specific traits in A. eucharioides (Fig.
Multivariate morphometrics
On species group-level, the morphometric analyses almost fully separate two groups in a PCA (Fig.
Results of morphometric analyses of the eucharioides species group against the immunis species group shape PCA shows almost full separation between species groups (Fig.
On species-level, restricted to the eucharioides species group, all species overlap in a PCA when included in the same analyses (Fig.
The PCA and ratio extractor results of the addional species-level analyses as well as the results of the allometry tests of all species group- and species-level comparisions are given in Suppl. material
Taxonomic section
Anacharis
Anacharis Dalman, 1823 - Type species: Cynips eucharioides Dalman, 1818.
Megapelmus Hartig, 1840 - Type species: Megapelmus spheciformis Hartig, 1840 (= Anacharis eucharioides (Dalman, 1818)).
Synapsis Förster, 1869 - Type species: Synapsis aquisgranensis Förster, 1869 (= Anacharis immunis Walker, 1835), homonymous with beetle genus Synapsis Bates, 1868.
Prosynapsis Dalla Torre & Kieffer, 1910 - Type species: Prosynapsis aquisgranensis (Förster, 1869) (= Anacharis immunis Walker, 1835) - replacement name for Synapsis Förster, 1869, due to the aforementioned homonymy.
Diagnosis
The genus Anacharis is characterised by an elongate, smooth petiole (sometimes with some vague longitudinal striae, but never sculptured as in Aegilips Walker, 1835 and Xyalaspis Hartig, 1843). The mesoscutellum does not overhang the propodeum (as sometimes in Aegilips and always in Xyalaspis). The mesoscutellum is posteriorly rounded, never extended apically (usually pointed in Aegilips, pointed or extended into a spine in Xyalaspis). The mesoscutellum always possesses a posterior carina that separates the mesoscutellum into a dorsal and posterior surface (circumscutellar carina absent, indistinct or present in Aegilips and Xyalaspis). The circumscutellar carina is sometimes posteriorly flanged upwards, appearing tooth-like in lateral view (never flanged upwards in Aegilips and Xyalaspis, if carina is present). The mesopleural line is exhibited as a rugose and/or striate furrow, often extending from the anterior to close to the posterior margin of the mesopleuron (mesopleural sculpture in Aegilips and Xyalaspis not concentrated in any sort of furrow but equally spread out along anterior margin, sometimes reduced to the anterior half of mesopleuron or totally absent). The metasoma is apically pointed, especially in females (metasoma apically ending more abruptly in Aegilips and Xyalaspis). The occiput is either smooth, striolate, or striate (smooth in Aegilips and Xyalaspis). The upper face has a usually shallow to sometimes more distinct median dent (Fig.
Etymology and grammatical gender
Derived from Greek “Ana (ἀνά, up, back, against, above, across, throughout, again, counter)” and “charis (Χάρις, grace, beauty, favour, loveliness)”. Dalman describes Anacharis as looking similar to eucharitids (
The grammatical gender of Anacharis is female (as used in
Remarks
The most recent diagnoses of the genus are presented in
The species groups
The presence of two groups within Anacharis is corroborated by all methods applied here, i.e. the molecular analysis (Fig.
The description of two species groups is well-suited to classify the Western Palaearctic fauna. Species from outside this region are currently not considered and species groups and their diagnoses might need revision after treatment of the Anacharis world fauna. For example, the placement of the Nearctic A. melanoneura into one of the species groups might be problematic, as females of the species are reported to have placodeal sensillae starting at flagellomere two (
immunis species group
Diagnosis. The genal carina is at a right angle to the vertical axis of the face in facial view (Figs
Species included. Anacharis ensifer Walker, 1835, stat. rev., A. immunis Walker, 1835 and A. norvegica Mata-Casanova & Pujade-Villar, 2018.
Remarks. Previously, the species of Anacharis were grouped by their petiole length relative to the hind coxa length.
The multivariate morphometrics on species group- level resulted in the addition of two diagnostic characters that are – in particular when combined – suited to separate specimens from either species group. Accordingly, the addition of morphometric analyses proved useful for separating Anacharis specimens on species group- level.
eucharioides species group
Diagnosis. The genal carina within the eucharioides species group is not at a right angle to the vertical axis of the face in facial view (e.g. Fig.
Species included. A. eucharioides (Dalman, 1818), A. martinae sp.nov., A. maxima sp. nov., A. minima sp. nov., A. petiolata (Zetterstedt, 1838), stat. rev. & A. typica Walker, 1835, stat. rev.
Remarks. For a discussion of the relationship between the two species groups, see remarks under immunis species groups.
The PCA of the eucharioides species group (Fig.
Anacharis ensifer , stat. rev.
Anacharis ensifer
Walker, 1835: 522 - lectotype (
Megapelmus rufiventris
Hartig, 1841: 358 (removed from synonymy with A. immunis) - lectotype (
Diagnosis
(n=13). Belongs to the immunis species group. Similar to A. norvegica in generally having a largely sculptured mesoscutellum (largely smooth in A. immunis) (Fig.
CO1 barcode
n=12. Maximum intraspecific distance = 0.5%. Minimum distance to closest species (A. immunis) = 7.8%. CO1 barcode consensus sequence:
AATTTTATACTTTATTTTAGGAATCTGGTCAGCAATATTAGGATCAAGACTTAGTATAATTATTCGAAT AGAATTAGGCACCCCATCTCAATTAATCAGAAATGACCAAATTTACAATTCAATTGTAACAGCTCATGCA TTTATTATAATTTTTTTTATAGTTATACCTATTATAGTCGGAGGATTTGGAAATTACCTAATTCCATTAA TACTCCTATCCCCAGATATAGCTTTCCCACGATTAAATAATATAAGATTTTGATTTCTAATCCCCTCTTT AATTTTAATAGCTTCAAGATTATTTATTGATCAAGGAGCAGGAACCGGATGAACAGTATATCCCCCTTTA TCTTCATTAACAGGTCACTCAGGGATTGCAGTAGACATAACAATTTACTCTCTTCATTTAAGAGGAATTT CTTCAATTTTAGGCTCAATTAATTTTATTAGAACAATTTTAAATATACGAATCAATAAAGTATCAATAGA TAAAATTACCCTATTTACATGATCAATTTTTTTAACTACAATTCTATTACTTTTATCATTACCCGTCCTA GCAGGAGGGATCACTATACTTTTATTTGACCGAAACTTAAATACCTCCTTTTTCGATCCCATAGGAGGAG GAGACCCAATTTTATATCAACATTTATTT
Type material
Lectotype of Anacharis ensifer Walker, 1835, designated by
F Walker Coll. 81–86
LECTO-TYPE
B.M. 1981 . Under A. ensifer
LECTOTYPE of A. ensifer Walker det. N.D.M.Fergusson, 1981
B.M. TYPE HYM 7. 161
[QR-code] NHMUK010640456
[for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10638964]
Lectotype of Anacharis rufiventris Hartig, 1841, designated by
LECTO-TYPE
Megapelmus n. sp. ? [handwritten, probably by Hartig himself]
rufiventris. [handwritten, probably by Hartig himself]
LECTOTYPE of Megapelmus rufiventris Hartig det. N.D.M.Fergusson 1982
Anacharis immunis det. N.D.M.Fergusson 1982
Other material examined
DNA barcode vouchers. Belgium • 1 ♀; West Flanders, Ypres, De Triangel, Urban park (bushes); 50.8418°N, 2.8838°E; ca 20 m a.s.l.; 2–23 Jul. 2022; Verheyde, Fons leg.; Malaise trap;
Norway • 2 ♂♂; Rogaland Ytre, Sola, Indraberget; 58.9124°N, 5.6628°E; ca 20 m a.s.l.; 24 Aug.-6 Sep. 2020; Leendertse, Arjen leg.; Malaise trap;
Material without DNA barcode. Belgium • 3 ♂♂; Walloon Brabant, Ottignies; 16–23 Jul. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0047 (RBINS), JV_Prel_0048 (RBINS), JV_Prel_0049 (RBINS). • 1 ♀; West Flanders, Ypres, De Triangel, Urban park (pool vegetation); 50.8427°N, 2.884°E; ca 20 m a.s.l.; 18 Jun.-2 Jul. 2022; Fons Verheyde leg.; Malaise trap;
Denmark • 1 ♂; Eastern Jutland, Alminde hule, 20 km S of Vejle; 30 May 1982; Torkhild Munk leg.;
Germany • 2 ♀♀; Bavaria, near Schwandorf; 49.3042°N, 12.1184°E; ca 360 m a.s.l.; Ernst Klimsa leg.; specimen in coll MF. • 1 ♂; Brandenburg, Potsdam-Mittelmark, Kleinmachnow; 22 Jun. 1925; S. Bollow leg.; JV_Prel_0042 (
The Netherlands • 1 ♀; Gelderland, Nijmegen, Gelderse poort; 23 Aug. 2022; R. Lexmond leg.; Malaise trap; JV_Prel_0050 (RBINS).
Norway • 2 ♀♀; Akershus, Baerum, Ostøya; 10 Jun.-1 Jul. 1984; Fred Midtgaard leg.;
Sweden • 1 ♀; Gotska sandön, Lilla lövskogen; 6 Aug. 1952; Anton Jansson leg.;
Switzerland • 1 ♀; Genève, La Louton; 12 Aug. 1960; André Comellini leg.; specimen at
Biology
Summer species, flying mainly from May to October, peak in August. Collected mainly in deciduous forest and in open nemoral habitats.
Distribution
Verified by morphological examination: Belgium, Denmark, Germany, The Netherlands, Norway, Sweden, Switzerland, United Kingdom (locus typicus: England, near London or Windsor forest).
No DNA barcode matches with publicly available sequences from other countries.
Lowland species, occurring in elevations below 400 m a.s.l.
Remarks
We remove A. ensifer from the synonymy with A. immunis that was established by
Walker’s original name Anacharis ensifer was changed into A. ensifera by
Almost all specimens of A. ensifer show an intermediate stage of sculpturing of the mesoscutellum between A. immunis (largely smooth) and A. norvegica Mata-Casanova & Pujade-Villar, 2018 (finely foveate on both dorsal and posterior surface of the mesoscutellum), with the exception of
Anacharis ensifer falls within the diagnosis of A. immunis in
Works prior to
Anacharis eucharioides
Cynips eucharioides Dalman, 1818: 78 - type lost.
Anacharis tinctus
Walker, 1835: 520 - lectotype (
Megapelmus spheciformis
Hartig, 1840: 202 (removed from synonymy with A. typica) - lectotype (
Anacharis fergussoni
Mata-Casanova & Pujade-Villar, 2018: 16 syn. nov. - holotype (
Anacharis eucharoides auct., common misspelling.
Diagnosis
(n=290). Most common species within the eucharioides species group. Medium sized body (2.7–3.4, mean 3.1 mm, similar to A. typica, A. petiolata & A. martinae). Differing from A. typica and A. petiolata by having a mesoscutellum with a median carina present, which is typically interrupted centrally by reticulation (largely smooth and even in A. petiolata and A. typica) (Fig.
CO1 barcode
n=289. Maximum intraspecific distance = 2.5%. Minimum distance to closest species (A. petiolata) = 2.9%. CO1 barcode consensus sequence:
AATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTTATACCTATTATAGTTGGAGGATTTGGGAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGAGCAGGAACAGGATGAACTGTTTACCCTCCATTA TCCTCCCTAACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAACTTCTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACGATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGAG GAGACCCTATTCTTTATCAACATTTATTT
Type material
Lectotype of Anacharis tinctus Walker, 1835, designated by
81 86 [on backside of mounting board]
Type
B.M.1981 . Under tincta
LECTO-TYPE
LECTOTYPE Anacharis tincta Walker det. N.D.M.Fergusson, 1981
B.M. TYPE HYM 7.162
[QR code]
[for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10470209]
Lectotype of Megapelmus spheciformis Hartig, 1840, designated by
Weld 1931
Megapelmus spheciformis [handwritten, probably by Hartig himself]
LECTOTYPE of MEGAPELMUS spheciformis det. N.D.M.Fergusson, 1982
Anacharis eucharoides Dal. det. N.D.M.Fergusson, 1982
Anacharis eucharioides (Dalman, 1818) ♂ Det. Jonathan Vogel 2024
Holotype of Anacharis fergussoni Mata-Casanova & Pujade-Villar, 2018
Germany • 1 ♀; Rhineland Palatinate, Mainz-Bingen, Ingelheim am Rhein, orchard; 1–30 Sep. 1968; I. Sreffan leg.; Malaise trap.
[for images, see https://www.cnc.agr.gc.ca/taxonomy/Specimen.php?id=3274133]
Other material examined
DNA barcode vouchers. Belgium • 1 ♀; East Flanders, Assenede, Isabellepolder, Agricultural land with Partridge mix; 51.266°N, 3.71°E; ca 0 m a.s.l.; 12–19 Jun. 2019; UGent leg.; yellow pan trap;
Germany • 1 ♂; Baden-Württemberg, Biberach, Altheim; 48.1399°N, 9.4491°E; ca 540 m a.s.l.; 6–19 Aug. 2013; Schmalfuß, H. leg.; Malaise trap;
Lithuania • 1 ♀; Silute distr., Sysa, Sysa, control plot; 55.3127°N, 21.4049°E; ca 0 m a.s.l.; 15–25 Jul. 2020; Petrasiunas, Andrius leg.; Malaise trap;
The Netherlands • 1 ♂; Noord-Holland, Amsterdam, Vondelpark; 52.3581°N, 4.8681°E; ca 0 m a.s.l.; 3–12 Jun. 2019; Taxon Expeditions Team leg.; Malaise trap;
Norway • 1 ♂; Rogaland Ytre, Finnøy, Nordre Vignes; 59.1679°N, 5.7883°E; ca 10 m a.s.l.; 22 Sep.-1 Nov. 2020; Tengesdal, Gaute leg.; Malaise trap;
Material without DNA barcode. Belgium • 1 ♂; Walloon Brabant, Ottignies; 3–10 Sep. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0057 (RBINS). • 1 ♀, 1 ♂; Walloon Region, Luik, Wanze, Antheit (Corphalie); 50.5363°N, 5.2515°E; ca 110 m a.s.l.; 14–28 Jul. 1989; R. Detry leg.; Malaise trap;
Denmark • 4 ♂♂; Southern Jutland, Rømø; 24 Sep. 2000; Torkhild Munk leg.;
Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Malsch, Luderbusch, south faced slope; 48.9131°N, 8.3325°E; ca 120 m a.s.l.; 26 Jul.-2 Aug. 2020; Dieter Doczkal | K. Grabow leg.; Malaise trap;
The Netherlands • 1 ♀; Gelderland, Beek-Ubbergen, Goudenregenstraat, garden; 51.8268°N, 5.9332°E; ca 10 m a.s.l.; 1 Oct. 2023; Jochem Kühnen leg.; hand caught;
Portugal • 1 ♂; Madeira, Funchal, Curral das Romeiros; ca 550 m a.s.l.; 8 Feb. 1991; Martti Koponen leg.; specimen in coll. Koponen.
Sweden • 1 ♂; Dalarna, Rättvik, Glostjärn; 20 May-30 Jun. 1977; Tord Tjeder leg.;
Switzerland • 1 ♀; Neuchâtel, Montmollin; 1 Aug. 1966; Jacques de Beaumont leg.; specimen at
Biology
Summer species, flying mainly from May to October, peak in July. Collected in all kinds of habitats: deciduous and coniferous forests, gardens, parks and orchards, agricultural fields, pastures and meadows, ruderal land, ponds and marshes
Distribution
Verified by morphological examination: Belgium, Denmark, Germany (locus typicus of A. spheciformis; locus typicus of A. fergussoni: Ingelheim am Rhein), Lithuania, The Netherlands, Norway, Portugal, Sweden (locus typicus of A. eucharioides: Västergötland), Switzerland, United Kingdom (locus typicus of A. tincta: unclear, either near London, Isle of Wight or Machynlleth (North Wales)).
CO1 barcode sequence matches: Belarus (e.g. GMBMQ746-17) and Canada (e.g. BBHYJ932-10).
Lowland species, usually occurring in elevations below 500 m a.s.l., rarely collected in higher altitudes, most specimens between 0–100 m a.s.l.
Remarks
A. eucharioides is both the most commonly collected and the most morphologically heterogeneous species within the genus Anacharis. Specimens often exhibit slight metallic sheen on their mesoscutum and head that is more notable in ethanol-stored specimens but sometimes retains on dried specimens.
The type of A. eucharioides is reportedly lost (
The lectotype of A. tincta is glued to its ventral side on cardboard, face down, the wings also glued to the board. It is overall intact, except the terminal four segments of the left antenna, which are detached from the rest to the specimen but still present on the cardboard. Also, the left fore tarsomeres are detached, the second tarsomere is missing, the rest is glued on the card. Both wings and legs obscure the lateral mesosoma on both sides. We here confirm the synonymy with A. eucharioides.
The lectotype of A. spheciformis (Hartig, 1840) was designated by
A. fergussoni is diagnosed against A. parapsidalis and A. melanoneura in
Comparison of morphometric values between A A. fergussoni in the description of
| Entities measured | Head dorsal width: length | Head frontal width: height | Malar sulcus length: eye height | Eye-to-eyee dist.: eye height | mesoscutum width:length | mesoscutellum_l mesoscutum_l | Radial cell length: width | Petiole length: metacoxa length |
|---|---|---|---|---|---|---|---|---|
|
A A. fergussoni in description ( |
2.4 | 1.3 | 0.7 | 1.1 | 1.2 | 0.6 | 2.7 | 2 |
| B A. fergussoni holotype, measured herein | 1.2 | 0.6 | 1.0 | 1.2 | 0.8 | 1.4 | ||
|
C A. eucharioides in redescription ( |
2 | 1.3 | 0.6 | 1 | 1.2 | 0.8 | 2.6 | >1 |
| D A. eucharioides range, measured herein | 1.8–2.3 | 1.0–1.3 | 0.6–0.8 | 1.0–1.1 | 1.0–1.2 | 0.6–0.8 | 2.4–3.3 | 1.0–1.7 |
We want to note that images of the holotype, kindly provided to kindly provided to us by the team at
Here, we demonstrate that, given the morphometric variability within A. eucharioides and the whole eucharioides species group, morphometric characters/analyses cannot reliably separate this species from the others (Fig.
Additional distribution records are listed in
Anacharis immunis
Anacharis immunis
Walker, 1835: 521 - lectotype (
Anacharis staegeri
Dahlbom, 1842: 4 - lectotype (
Synapsis aquisgranensis
Förster, 1869: 361 - Holotype (ZMHB) ♂, syn. by
Diagnosis
(n = 14). Belongs to the immunis species group. Anacharis immunis can be distinguished from A. ensifer and A. norvegica by having a largely smooth and even dorsal surface of the mesoscutellum, especially centrally (reticulate-foveate in A. ensifer and A. norvegica) (Fig.
CO1 barcode
n = 14. Maximum intraspecific distance = 0.2%. Minimum distance to closest species (A. ensifer) = 7.8%. CO1 barcode consensus sequence:
AATTTTATACTTTATTATAGGAATCTGATCAGCAATATTAGGATCAAGACTTAGTATAATTATCCGAAT AGAATTAGGGACTCCATCACAATTAATTAGAAATGAACAAATTTACAATTCAATTGTAACCGCACATGCA TTTATCATAATTTTTTTTATAGTTATACCTATTATAGTAGGAGGATTTGGAAATTACCTAATCCCATTAA TACTTTTATCTCCAGATATAGCTTTTCCACGATTAAATAATATAAGATTTTGATTTTTAATTCCCTCTTT AGCTTTAATATCTTCTAGTTTATTTATTGATCAAGGGGCAGGAACAGGATGAACAATTTACCCTCCTTTA TCTTCATTAACAGGACACTCAGGAATTGCAGTAGATATAACAATCTACTCCCTTCATTTAAGAGGAATTT CTTCAATTTTAGGATCAATTAATTTTATCAGAACAATTTTAAACATACGAATTAATAAAGTATCAATAGA TAAAATTACTCTATTTAGATGATCAATCTTTTTAACTACAATTTTATTACTTCTATCATTACCTGTGCTT GCAGGAGGAATTACTATACTTTTATTTGACCGAAACTTAAACACCTCCTTTTTCGACCCCATAGGGGGAG GAGACCCAATCTTATATCAACATTTATTT
Type material
Lectotype of A. immunis Walker, 1835:
Type
immunis, Walk. [handwritten, probably by Walker himself]
In coll under immunis
LECTOTYPE
B.M. TYPE HYM 7. 160
LECTOTYPE of A. immunis Walker det. N.D.M.Fergusson, 1981
[QR code] NHMUK010640455
[for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10638963]
Lectotype of A. staegeri Dahlbom, 1842:
♀
LECTOTYPE
LECTOTYPE of Anacharis staegeri Dahlm det. N.D.M.Fergusson, 1983
1983 366
[for images, see https://www.flickr.com/photos/tags/mzlutype06511]
Other material examined
DNA barcode vouchers. Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße, garden; 48.8835°N, 8.3197°E; ca 120 m a.s.l.; 25 Oct.-8 Nov. 2020; Dieter Doczkal leg.; Malaise trap;
Material without DNA barcode. Belgium • 1 ♂; Walloon Brabant, Ottignies; 9–16 Jul. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0073 (RBINS). • 1 ♀; same collection data as for preceding 24 Sep.-1 Oct. 1983; JV_Prel_0051 (RBINS). • 1 ♀; Walloon Region, Luik, Wanze, Antheit (Corphalie); 50.5363°N, 5.2515°E; ca 110 m a.s.l.; 16–30 May 1989; R. Detry leg.; Blue pan trap; JV_Prel_0056 (RBINS).
Denmark • 1 ♂; Eastern Jutland, Fugslev; 56.2667°N, 10.7167°E; ca 20 m a.s.l.; 1999; Torkhild Munk leg.;
Germany • 1 ♀; Bavaria, Garmisch-Partenkirchen, Zugspitze, mountain; 47.4053°N, 11.0091°E; ca 1980 m a.s.l.; 2–13 Aug. 2018; Dieter Doczkal | Johannes Voith leg.; Malaise trap;
Sweden • 1 ♀; Närke, Örebro, Adolfsberg; 19 Sep. 1953; Anton Jansson leg.;
Switzerland • 1 ♂; Neuchâtel, Auvernier; 1 Aug. 1953; Jacques de Beaumont leg.; specimen at
Biology
Summer species, flying mainly from July to September, peak in July. No clear habitat preference but in Sweden and Denmark often collected in open sandy pine forest.
Distribution
Verified by morphological examination: Belgium, Denmark, Germany (locus typicus of A. aquisgranensis: Aachen and Megapelmus rufiventris Hartig, 1841), Sweden (locus typicus of A. staegeri), Switzerland, United Kingdom (locus typicus of A. immunis: near London).
No DNA barcode matches with publicly available sequences from other countries.
Mainly collected in lowlands below 400 m a.s.l., occasionally found in higher altitudes at 700–900 m a.s.l. and rarely even higher.
Remarks
Anacharis aquisgranensis was described by Förster (1869) because of its holotype having the mesoscutum fused with the mesoscutellum. He even erected the monotypic genus Synapsis (later replaced by Prosynapsis Dalla Torre & Kieffer, 1910, due to homonymy) based on that state.
The distribution records of A. immunis reported by
Anacharis martinae , sp. nov.
Diagnosis
(n = 18). Belongs to the eucharioides species group. Medium sized species (2.6–3.3, mean 2.9 mm, similar to A. eucharioides, A. petiolata and A. typica). Different from A. petiolata and A. typica in having a centrally carinate mesoscutellum (Fig.
Description
Both sexes. Size. Body: ♀ 2.6–3.2 (3.2) mm, ♂ 2.3–2.9 mm. Antennae: ♀ 1.7–2.3 (2.1) mm, ♂ 2–2.3 mm. Fore wing: 2.1–2.8 (2.5) mm
Colour. Body black to reddish-brown (Fig.
Head. Roundish-trapezoid in frontal view, genae gently kinked, in an angle <90° to the vertical axis of the face (Fig.
Antennae. ♀ formula:
1.9–2.3(2.1):1:2.1–2.8(2.5):1.6–2.1(2.0):1.4–2(1.8):1.3–1.9(1.8):1.3–1.7(1.6):1.3–1.6(1.6):1.3–1.7(1.5):1.3–1.6(1.4):1.1–1.5(1.4):1.1–1.5(1.4):2.1–2.5(2.3)
♂ formula:
1.6–2.7:1:2–2.9:1.6–2.5:1.4–2.3:1.3–2:1.3–1.9:1.3–2.1:1.3–2:1.3–2:1.1–2:1.1–2:1.3–2
Mesosoma. Mesosoma 1.3–1.4(1.4) times longer than high (Fig.
Wings. Marginal cell of fore wing 2.5–2.8 (2.6) times longer than wide (Fig.
Metasoma. 0.9–1.2 (1.2) times longer than rest of body (Fig.
Male genitalia. Parameral plate submedially widened, basoventral margin rounded, without tooth.
Males. Flagellomeres dorsoventrally bicoloured yellow-dark brown, gaster shorter than in females. T7 in males almost entirely punctured except medially, long setae across surface, except on smooth area.
Variation
The specimens from the Bavarian Forest National Park (BC-
CO1 barcode
n=18. Maximum intraspecific distance = 2.3%. Minimum distance to closest species (A. eucharioides) = 7.9%. CO1 barcode consensus sequence:
AATTTTATACTTTATTTTAGGTATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAACTCAATTGTAACTGCTCATGCA TTTATTATAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTATCTGGTTCCTCTAA TACTAATTTCTCCTGATATAGCCTTCCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCATCCCT ATTTTTAATAACAATAAATTTATTTATTGATCAAGGAGCTGGTACAGGATGAACTGTATACCCTCCACTA TCCTCCTTAACGGGTCATCCATCAATATCAGTAGATTTAGTTATTTATTCTCTTCATTTAAGAGGAATTT CTTCAATTCTTGGTTCAATTAATTTTATTGTAACAATTTTAAATATACGAATAAACTCAATAACAATAGA TAAAATTTCATTATTCATTTGATCTATTTTTTTAACAACTATTTTACTATTATTATCATTACCTGTATTA GCTGGAGGTTTAACAATATTACTTTTTGATCGAAACTTAAATACATCATTTTTTGATCCTACAGGAGGAG GAGACCCAATTTTATATCAACATTTATTT
Type material
Holotype. Germany • ♀; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Banfehaus, old floodplain of the Banfe; 51.167°N, 8.9749°E; ca 270 m a.s.l.; 22 Jul.-5 Aug. 2021; GBOL III leg.; Malaise trap (Krefeld version);
Paratypes. Germany • 2 ♂♂; same collection data as for holotype;
Other material examined
Without DNA barcode. Belgium • 1 ♀; Walloon Region, Namur, Nismes; 50.0744°N, 4.5556°E; ca 220 m a.s.l.; 10 Jul. 2022; W. Declercq leg.; Light trap;
France • 1 ♂; Bitche; 7 Aug. 1979; Henk J. Vlug leg.; sweep net; specimen in coll MF.
Sweden • 1 ♂; Hälsingland, Skog sn, Noran; 5 Aug. 1949; Olov Lundblad leg.;
Switzerland • 1 ♂; Neuchâtel, Auvernier; 8 Aug. 1957; Jacques de Beaumont leg.; specimen at
Biology
Summer species, flying mainly from June to September, peak in July. No clear preferences in terms of habitat.
Distribution
Belgium, France, Germany (locus typicus: Kellerwald-Edersee National Park, Banfehaus), Sweden, Switzerland.
No DNA barcode matches with publicly available sequences from other countries.
Mainly collected in lowlands below 400 m a.s.l., occasionally found in higher altitudes at 700–900 m a.s.l. and rarely even higher.
Etymology
Named after the first author’s wife, Martina Vogel.
Remarks
In the molecular analysis, A. martinae is split into two clades by ASAP. The gap between the two clusters is 2.3% and cannot be attributed to poor quality sequences. As ASAP is the only analysis to split this cluster by that gap and we cannot find morphological evidence for a split into two species, we regard this result as an oversplit.
The diagnosis against A. belizini is based on the description and the accompanying SEM images of the holotype in
On the SEM images of A. belizini, the pronotal plate is significantly laterally projecting in dorsal view (Fig.
The morphometric analysis (Fig.
Anacharis maxima , sp. nov.
Diagnosis
(n = 6, all males). Belongs to the eucharioides species group. Large species (3.5–4.0, mean 3.8 mm, unique in Northwestern European fauna). Similar to A. eucharioides by having the lateromedial area of the pronotum smooth to rugose (Fig.
Description
Male. Size. Large; body: 3.5–4.0 (3.9) mm; antennae: 2.7–3.4 (3.1) mm; fore wing: 2.5–3.3 (3.3) mm
Colour
. Body black (Fig.
Head. Trapezoid in frontal view, genae abruptly kinked, meeting mandibular base in an angle < 90° (Fig.
Antennae . ♂ formula:
2.1-2.4(2.2):1:2.6-2.7(2.7):2.3-2.4(2.4):2.2-2.3(2.2):2-2.1(2.1):2-2.1(2):1.9-2.1(1.9):1.9-2(1.9):1.8-2(1.9):1.8-1.9(1.8):1.7-1.9(1.8):1.7-1.8(1.7):2-2.6(2.5)
Mesosoma. Mesosoma 1.3 times longer than high (Fig.
Wings. Marginal cell of fore wing 2.6–2.9 (2.6) times longer than wide (Fig.
Metasoma. 1.3 times longer than rest of body (Fig.
Male genitalia. Parameral plate basally widened, ventrally with basal tooth-like projections pointing inwards (Fig.
Female. Unknown.
CO1 barcode
n=7. Maximum intraspecific distance: 0%. Minimum distance to closest species (A. eucharioides): 3.9%. CO1 barcode consensus sequence:
TATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGGACCCCATCCCAATTAATTATAAATGATCAAATTTATAATTCAATTGTAACTGCACATGCA TTTATTATAATTTTCTTTATAGTTATACCTATCATAGTAGGAGGATTTGGAAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTCCCTCGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGGACAGGAACAGGATGAACTGTTTATCCCCCATTA TCATCCATCACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CTTCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAATCTCCATATCTATAGA CAAAGTCTCATTATTTATTTGATCTATTTTTTTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACTATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGAG GAGACCCTATTCTTTATCAACACTTATTT
Type material
Holotype. Germany • ♂; Bavaria, Rhön-Grabfeld, Hausen, Eisgraben, basalt depot at forest margin; 50.5026°N, 10.0895°E; ca 740 m a.s.l.; 12–23 Jul. 2018; Dieter Doczkal leg.; Malaise trap;
Paratypes. Germany • 5 ♂♂; Same collection data as for holotype;
Other material examined
Without DNA barcode. Sweden • 1 ♂; Uppland, Norrtälje, Singö; 15 Jul. 1962; Karl-Johan Hedqvist leg.;
Switzerland • 1 ♂; Vaud, Aigle, Solalex; 4 Aug. 1954; Jacques Aubert leg.; specimen at
Biology
Summer species, flying from July to August, peak in July. No clear preferences in terms of habitat.
Distribution
Germany (locus typicus: Bavaria, Rhön-Grabfeld, Hausen, Eisgraben), Sweden, Switzerland.
No DNA barcode matches with publicly available sequences from other countries.
Probably preferring higher altitudes, as all specimens were collected at 400 to 800 m a.s.l.
Etymology
From the latin word “maximus”, meaning the greatest, referring to the tall size of the species.
Remarks
A. maxima is not frequently collected, though with six specimens caught from one collection event at one site, it seems like it can be locally relatively abundant. The diagnosis against A. parapsidalis is based on comparisons with the SEM images and the redescription (
The morphometric analysis revealed only little overlap of A. maxima with the other species within the eucharioides species group (Fig.
Anacharis minima , sp. nov.
Diagnosis
(n = 1). Belongs to the eucharioides species group. Small species (2.4 mm). Similar to A. petiolata and A. typica by having a centrally smooth mesoscutellum (centrally carinate in A. eucharioides, A. martinae and A. maxima). The small body size and the narrow coriaceous texture of the malar space that extends only around the dorsal corner of the mandibular base (Fig.
Description
Female. Size. Small; body: ♀ 2.4 mm. Antennae: ♀ 1.6 mm. Fore wing: 1.9 mm
Colour. Body black (Fig.
Head. Roundish triangular in frontal view, genae not abruptly kinked (Fig.
Antennae. ♀ formula:
1.9:1.0:2.1:1.4:1.4:1.4:1.4:1.3:1.2:1.2:1.2:1.1:2.1
Mesosoma. Mesosoma 1.3 times longer than high (Fig.
Wings. Marginal cell of fore wing 2.6 times longer than wide.
Metasoma. 1.2 times longer than rest of body (Fig.
Male. Unknown
CO1 barcode
n=1. Maximum intraspecific distance = not applicable. Minimum distance to closest species (A. eucharioides) = 5.6%. CO1 barcode consensus sequence:
AATTTTATACTTTATTTTAGGTATTTGATCCGGAATAATAGGTTCAAGATTAAGAATAATTATTCGAAT AGAACTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACCGCACATGCC TTTATTATAATTTTTTTTATAGTTATACCCATTATAGTAGGAGGATTTGGAAATTATTTAGTGCCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCCT ATTTTTAATAACAATTAACTTATTTATTGATCAAGGAGCAGGGACAGGATGAACTGTATACCCACCATTA TCATCCCTCACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTATTCACTACATTTAAGAGGTATCT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAAACTCTGTATCTATAGA CAAAATTTCATTATTTATTTGATCTATCTTTTTAACTACAATTTTACTATTATTATCTTTACCTGTATTA GCAGGAGGATTAACTATATTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGGG GAGACCCAATTCTTTATCAACACTTATTT
Type material
Holotype. Germany • ♀; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße, garden; 48.8835°N, 8.3197°E; ca 120 m a.s.l.; 25 Oct.-8 Nov. 2020; Dieter Doczkal leg.; Malaise trap;
Biology
The holotype was collected in autumn (between October and November) in a garden.
Distribution
Germany (locus typicus: Karlsruhe, Malsch).
No DNA barcode matches with publicly available sequences from other countries.
Holotype collected from ca. 120 m a.s.l.
Etymology
From the latin word for “the smallest”, referring to its distinct small body size.
Remarks
While A. minima is molecularly clearly distinct from other species, the morphology overlaps in many aspects with other species that show a smooth mesoscutellum. It is the name-giving small size that seems to hold the most diagnostic value but there is no way to say for sure which characters are morphologically diagnostic for A. minima based on a single specimen. Some specimens, which we currently classify as A. typica (
Anacharis norvegica
Diagnosis
(n = 1). Belongs to the A. immunis species group. Similar to A. ensifer in generally having a largely sculptured mesoscutellum (largely smooth in A. immunis). Different to A. ensifer by having its mesoscutellum covered with reticulate-foveate sculpture resulting in smaller foveae (larger foveae in A. ensifer). The circumscutellar carina is less distinct and not flanged upwards posteriorly (usually distinctly flanged upwards, appearing in lateral view like a posterodorsal tooth in A. ensifer and A. immunis). The dorsal margin of the mesopleural line is diffused by rugose sculpture of mesopleuron in its anterior half (dorsally well-defined mesopleural line in its anterior half in A. ensifer and A. immunis). Wrinkles on mesoscutum, especially in anteromedian area, strong, making the anteroadmedian signa distinct (less to no wrinkles and thereby less notable anteroadmedian signa in A. ensifer and A. immunis).
Other material examined
Material without DNA barcode. Sweden • 1 ♀; Torne lappmark, Kiruna, Abisko Nationalpark, dry sparse alpine downy birch forest; 68.3539°N, 18.7822°E; ca 410 m a.s.l.; 21 Jul.-7 Aug. 2003; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap;
Biology
Summer species, type series collected in July and August, as was the specimen studied here. Probably preferring boreal habitats.
Distribution
Norway (locus typicus: Oppdal), Sweden.
Collected in higher elevations from 400 (specimen studied here) to 900 m a.s.l. (type series).
Remarks
Despite not having had a fresh specimen at hand for sequencing, we regard this species as different from A. ensifer due to the clear differences in sculpture of the mesoscutum, mesoscutellum and mesopleuron.
The species was described from one locality in central Norway (Oppdal) (
Anacharis petiolata , stat. rev.
Cynips petiolata
Zetterstedt, 1838:409 - lectotype (
Anacharis gracilipes
Ionescu, 1969:75 syn. nov. (removed from synonymy with A. eucharioides) - holotype (
Diagnosis
(n = 9). Belongs to the eucharioides species group. Medium sized species (3.0–3.4, mean 3.2 mm, similar to A. eucharioides, A. martinae and A. typica). Differing from A. eucharioides and A. martinae by having a centrally smooth mesoscutellum (Fig.
CO1 barcode
n=9. Maximum intraspecific distance: 2.2%. Minimum distance to closest species (A. eucharioides): 3.2%. CO1 barcode consensus sequence:
AATTTTATACTTTATTTTAGGTATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAGTTAGGTACCCCATCTCAATTAATTATAAATGATCAAATTTATAATTCAATTGTAACTGCACATGCA TTTATCATAATTTTCTTTATAGTTATACCTATCATAGTAGGAGGATTTGGAAATTATTTAGTACCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCACGATTAAATAATTTAAGATTTTGATTTGCAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATCGACCAAGGAGCAGGAACAGGATGAACTGTTTATCCTCCATTA TCCTCTCTAACAGGTCACCCATCTATATCAGTAGATTTAGTTATTTATTCATTACATTTAAGTGGAATCT CTTCAATTCTTGGATCAATTAATTTTATTGTTACCATTTTAAATATACGAATAAATTCTATATTTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACTATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGGG GAGACCCAATCCTTTATCAACATTTATTT
Type material
Lectotype of Cynips petiolata Zetterstedt, 1838
LECTO-TYPE
C. petiola ta ♀.
1982 855
LECTOTYPE Cynips petiolata Zett det. N.D.M.Fergusson, 1982
Anacharis eucharoides (Dal.) det. N.D.M.Fergusson, 1982
[for images, see https://www.flickr.com/photos/tags/mzlutype07814]
Holotype of Anacharis gracilipes
Anacharis gracilipes n. sp. ♀ Holotip
26.7.956 Rarău,
GAL 0340/9
Anacharis eucharoides ♀ (Dalman, 1823) JP-V 2012 det
HOLOTYPUS, Anacharis gracilipes Ionescu, 1969,
[Fig.
Other material examined
DNA barcode vouchers. Germany • 1 ♀; Bavaria, Allgäu, Oberstdorf, Oytal, Schochen, alpine meadow; 47.392°N, 10.37°E; ca 1930 m a.s.l.; 6 Aug. 2014; BC-
Greenland • 1 ♀, 2 ♂♂; SouthWest Greenland, Evighedsfjord, Kangiussaq; 65.8667°N, -52.2°E; ca 30 m a.s.l.; 19 Jul.-20 july 2003; Kissavik Exp.,
Material without DNA barcode. Germany • 1 ♂; Bavaria, Garmisch-Partenkirchen, Zugspitze, mountain; 47.4053°N, 11.0091°E; ca 1980 m a.s.l.; 18 Jul.-2 Aug. 2018; Dieter Doczkal | Johannes Voith leg.; Malaise trap;
Greenland • 1 ♀; Narssarssuaq; 61.1°N, -45.25°E; ca 0 m a.s.l.; 5 Jul. 1983; Peter Nielsen leg.; NHMD918327 (
Switzerland • 1 ♀; Neuchâtel, Auvernier; 16 Aug. 1956; Jacques de Beaumont leg.; specimen at
Biology
Summer species, flying from July to September, peak in July. Seems confined to alpine, arctic or boreal habitats.
Distribution
Finland (locus typicus of A. petiolata: Lapland, Muonio, likely on Finnish side of Muonio River, see remarks), Germany (Alps), Greenland, Romania (locus typicus of A. gracilipes: Rarău massif (Eastern Romanian Carpathians) at “1,950 m” altitude according to
DNA barcode matches with publicly available sequences from Canada (e.g. ABINP3207-21) and Norway (e.g. GWNWG2160-14).
In Central Europe restricted to elevations above 1900 m a.s.l. but occurring at lower altitudes in arctic and subarctic, boreal landscapes.
Remarks
A. petiolata (Zetterstedt, 1838, often erroneously cited as Zetterstedt, 1840) was synonymised with A. eucharioides by
There are no descriptive labels on the lectotype.
On the primary type of A. gracilipes:
The holotype was kept in a vial with ethanol, already damaged, lacking head and wings, legs incomplete. We mounted the specimen on a white pointed card with Shellac Gel glue on the right side of its mesosoma after asking permission from
A. petiolata is morphologically very similar to A. typica. The morphological differences are rather subtle differences in colouration and morphological diagnoses for both species are rather weak. Still, we differentiate between the two species based on the distinct difference in CO1 barcode sequences as well as a difference in habitat type/distribution. All known specimens of A. petiolata were collected in alpine or boreal environments, specimens of A. typica were collected in temperate environments below 700 meters above sea level.
Anacharis typica , stat. rev.
Anacharis typicus
Walker, 1835:520 - lectotype (
Diagnosis
(n = 10). Belongs to the eucharioides species group. Medium sized species (2.9–3.5, mean 3.2 mm, similar to A. eucharioides, A. martinae and A. petiolata). Differing from A. eucharioides and A. martinae by having a centrally smooth mesoscutellum (Fig.
CO1 barcode
n=10. Maximum intraspecific distance: 0.5%. Minimum distance to closest species (A. eucharioides): 5.7%. CO1 barcode consensus sequence:
AATTTTATACTTTATTTTAGGAATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGGACCCCCTCTCAATTAATTATAAATGATCAAATTTATAACTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTCATACCTATTATAGTAGGAGGATTCGGAAATTATTTAGTGCCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCCCGATTAAATAATTTAAGATTTTGATTTTTAATCCCCTCTTT ATTTTTAATAACAATTAATTTATTTATTGACCAAGGAGCAGGAACAGGGTGAACTGTATACCCCCCATTA TCATCACTCACAGGTCATCCATCTATATCGGTAGATTTAGTTATTTATTCATTACATTTAAGTGGAATTT CCTCAATTCTTGGTTCTATTAATTTTATTGTAACCATTTTAAATATACGAATAACTGTTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTTTAACTACAATTTTATTATTATTATCTTTACCAGTACTA GCAGGAGGTTTAACTATATTACTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGAG GGGATCCAATCCTTTATCAACACTTATTT
Type material
Lectotype of Anacharis typicus Walker, 1835
81 61 [on backside of mounting board]
2.
Type
In Coll under typical
B.M.1981 . Under typica
LECTOTYPE
LECTOTYPE Anacharis typica Walker det. N.D.M.Fergusson, 1981
B.M. TYPE HYM 7. 163
[QR code]
[for images, see Fig.
Other material examined
DNA barcode vouchers. Austria • 1 ♂; Styria, NP Gesäuse, Gsengquelle; 47.5683°N, 14.5902°E; ca 680 m a.s.l.; 2 Sep. 2015; Haseke leg.;
Belgium • 1 ♀; West Flanders, Beernem, Centrum; 51.1259°N, 3.3202°E; ca 10 m a.s.l.; 8 May 2022; De Ketelaere, Augustijn leg.; hand picked;
Germany • 1 ♀; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Maierwiesen; 51.1555°N, 9.0015°E; ca 370 m a.s.l.; 22 Jun.-8 Jul. 2021; GBOL III leg.; Malaise trap (Krefeld version);
Lithuania • 1 ♀; Silute distr., Sysa, Sysa, control plot; 55.3127°N, 21.4049°E; ca 0 m a.s.l.; 14–25 Jun. 2020; Petrasiunas, Andrius leg.; Malaise trap;
Material without DNA barcode. Belgium • 2 ♂♂; Walloon Brabant, Ottignies; 9–16 Jul. 1983; Paul Dessart leg.; Malaise trap; JV_Prel_0074 (RBINS), JV_Prel_0045 (RBINS). • 2 ♂♂; same collection data as for preceding 28 May-4 Jun. 1983; JV_Prel_0075 (RBINS), JV_Prel_0076 (RBINS). • 1 ♂; West Flanders, Harelbeke, Gavers, Wetland with pools; 50.8379°N, 3.3215°E; ca 10 m a.s.l.; 11 Jun. 2022; Bart Lemey leg.; hand caught; JV_Prel_0052 (RBINS).
Germany • 1 ♂; Hesse, Werra-Meißner-Kreis, Großalmerode, Private garden, Siedlerweg, semi-abandoned garden with wet spot, ivy hedge and salix; 51.2591°N, 9.7871°E; ca 380 m a.s.l.; 12–20 Jul. 2022; Jonathan Vogel leg.; Malaise trap;
Italy • 1 ♂; Val d’Aoste, Boertolaz, (Villeneuve); ca 800 m a.s.l.; 15 Sep. 1978; L. Martile leg.; Malaise trap;
Sweden • 1 ♂; Gotland, Eksta sn, Stora Karlsö, calcarous low herb pasture; 57.2873°N, 17.9775°E; ca 40 m a.s.l.; 26–29 Aug. 2014; Hymenoptera Inventory 2014 leg.; Malaise trap; MT Loc#2;
Switzerland • 1 ♀; Grisons, Pontresina; unknown leg.; specimen at
Biology
Summer species, flying mainly from April to September, peak in July. No clear preferences in terms of habitat.
Distribution
Austria, Belgium, Germany, Italy, Lithuania, Sweden, Switzerland, United Kingdom (locus typicus of A. typica: southern England, near London or Isle of Wight).
Found in elevations up to 400 m a.s.l., rarely up to 800 m a.s.l.
Remarks
The specimen labelled as lectotype is clearly a female, not a male as stated by
The lectotype is glued to its ventral side on cardboard, face down, wings also glued to the board. It is overall intact, though the 13th antennal segment is either broken in half and the fragment is lost, or the segment is malformed. The tarsomeres of the right fore leg are missing from second tarsomere onwards. Both wings and legs obscure the lateral mesosoma on both sides.
With 2.6 mm body length, the lectotype is a comparably small specimen of this species (average body length 3.2 mm). Additionally, the lectotype is unusual by its overall reddish colouration, which may have been caused by ageing. Otherwise, it is morphologically well-fitting with the specimens we examined.
For a comparison of the similar A. typica and A. petiolata, see the remarks section of A. petiolata.
One specimen from Belgium (JV_Prel_0076) was similarly coloured as the Bavarian specimens (BC-
In the distribution section we only list those records that we can verify by having seen actual specimens. Additional distribution records can be inferred from sequences from BOLD, if they match with our species cluster of A. typica. They were obtained from specimens originating from Canada (e.g. SMTPI9646-14). The identities of these sequences as A. typica need to be confirmed by examination of the physical specimens before reliably citing A. typica for Canada.
Key to the Northwestern European species of Anacharis (females and males)
The characters used in this key are, in part, based on the comparison of a small number of specimens (most notably A. minima, A. petiolata and A. typica). Note especially our concern that the colouration of specimens may be sensitive to the method of killing and the state of the specimen’s preservation. Due to the high degree of inter- and intraspecific variability, we stress that the most reliable way to identify the species of Anacharis is via comparison of DNA barcode data.
| 1 | Occiput smooth (Fig. |
2 |
| – | Occiput with at least some noticeable transversal striolation to striation laterally to medially (Fig. |
4 |
| 2 | Dorsal surface of mesoscutellum largely smooth and even, especially centrally (Fig. |
A. immunis Walker, 1835 |
| – | Dorsal surface of mesoscutellum with an uneven to reticulate-foveate sculpture centrally (Fig. |
3 |
| 3 | Dorsal and posterior surface of mesoscutellum heavily foveate, usually with small foveae that continue on posterior surface of mesoscutellum (Fig. |
A. norvegica Mata-Casanova & Pujade-Villar, 2018 |
| – | Dorsal surface of mesoscutellum reticulate-foveate (Fig. |
A. ensifer Walker, 1835, stat. rev. |
| 4 | Dorsal surface of mesoscutellum centrally with sculpture (Fig. |
5 |
| – | Dorsal surface of mesoscutellum largely smooth and even (Fig. |
7 |
| 5 | Dorsal surface of mesoscutellum with well-defined reticulate carinae in the anterior half between the mesoscutellar foveae, in other areas largely smooth or variable (Fig. |
A. maxima Vogel, Forshage & Peters, sp. nov. |
| – | Sculpture of mesoscutellum different; medium sized species, 2.6–3.4 mm body size | 6 |
| 6 | Lateromedial area of pronotum smooth to rugose (Fig. |
A. eucharioides Dalman, 1818 |
| – | Lateromedial area of pronotum sculptured with parallel longitudinal carinae like ventrally (Fig. |
A. martinae Vogel, Forshage & Peters, sp. nov. |
| 7 | Small sized species, around 2.4 mm body size; carination of notauli absent; with narrow coriaceous texture of the malar space that extends only around the dorsal corner of the mandibular base (Fig. |
A. minima Vogel, Forshage & Peters, sp. nov. |
| – | Medium sized species, around 3 mm body size; carination of notauli variable; band of coriaceous texture of malar space extending along entire length of mandibular base (Fig. |
8 |
| 8 | Collected in boreal environments or above 1,000 meters above sea level; hind coxa less distinctly bicoloured, though weak paling is notable apically, hind trochanter usually as dark as hind coxa (Fig. |
A. petiolata Zetterstedt, 1838, stat. rev. |
| – | Collected in nemoral environments, below 700 meters above sea level; hind coxa often distinctly bicoloured, with noticable paling apically, hind trochanter in has a similar pattern of paling as hind coxa or is as pale as in hind femur (Fig. |
A. typica Walker, 1835, stat. rev. |
Discussion
By integrating analyses of CO1 barcode data, morphological examination, multivariate morphometrics, WIPs and male genitalia dissections, we were able to detect and delimit nine species of Anacharis in Northwestern Europe, belonging to two species groups. The presence of more than two species is in line with the findings of
Delimiting species based on morphology proved comparatively difficult due to overall similarity of the species, and strong intraspecific variation. We acknowledge that previous studies which did not include analyses of molecular sequence data, and thereby not having a chance of being informed by a reverse taxonomy approach, were not able to fully delimit the Northwestern European species. Specifically, we found the following previously used characters to vary considerably intraspecifically: The setosity of the eyes, the parascutal sulcus, the depth and carination of the notauli, the mesoscutellar sculpture, the propodeal sculpture, and the petiole length:hind coxa length ratio. We briefly discuss the states of each of these characters as well as their diagnostic value.
Regarding the setosity of the eyes, all species treated in
Regarding the parascutal sulcus, it was used in couplet three of the key, in the (re-) descriptions of the species, but not in the diagnoses in
The notauli can be shallow and weak with no carination inside, as well as distinct and deep, with strong carination in the same species. The expression of the notauli may serve to exemplarily describe intraspecific variability of characters that we observed in Anacharis: Most specimens share what can be called a “typical pattern” but others contribute to the strong variation, either being more or less pronounced in the expression of the character. This makes it seemingly easy when studying a limited number of specimens but adds to an increasingly blurry piucture when studying a large number of specimens before being finally able to correctly evaluate and describe a character. Again, note that this would have been tremendously difficult if not impossible without the reciprocal information from analyses of sequence data.
Regarding the mesoscutellar sculpture – on both dorsal and posterior face – we see a pattern similar to what we described above for the notauli. However, when generally smooth and even (as in A. typica, A. petiolata, A. immunis and A. minima) or when distinctly carinate (as in A. ensifer, A. eucharioides, A. martinae, A. maxima and A. norvegica), mesoscutellar sculpture can be of diagnostic value.
The propodeal sculpture is intraspecifically variable, especially in the median part of the propodeum. From our examination, it cannot be used diagnostically between species.
Especially if qualitative characters are difficult to find, multivariate morphometric analyses can be executed. Our results, however, show that – generally – morphometric characters in Anacharis are of very limited use (Figs
The analyses of molecular sequence data, implementing more than one automated species delimitation method as should be common practice (
In addition to molecular sequence data, morphology and morphometrics, we further explored the use of WIPs in the alpha taxonomy of Figitidae. We found it to be useful for species group diagnostics and potentially also for separating species, as shown for the newly described species A. martinae and A. maxima. With an optimised protocol, the WIPs on areas like the radial and median areas of fore and hind wing could potentially emerge better and be further evaluated for their use in species delimitation. However, to do that reliably, larger series of better-quality images are required for each species. Once established, ideally on species level, WIPs might also be used for automated species recognition. This has great potential, especially when applying a trained AI to recognise the species (
From our first steps in evaluating male genitalia for their specific diagnostic power in Figitidae, we report some interspecific differences, most notably between the eucharioides and immunis species groups. On the species level, we could find differences in male genitalia morphology in the cases of A. eucharioides and A. maxima only. The differences are however subtle and nowhere close to the diversity of male genitalia morphology of the Ceraphronoidea (Salden & Peters, 2023). Like in other groups of microhymenoptera, the dissection of the male genitalia is difficult and yet we would argue that consulting male genitalia generally is a strategy worth investigating in parasitoid wasp taxonomy when there is a shortage of diagnostic characters.
Hemerobiiform Neuroptera are comparably poor in natural enemies (
Among the Anacharitinae in Northwestern Europe, Anacharis is the most commonly occurring genus. Yet, the taxonomic turmoil (
The DNA barcode dataset we provide is currently the most comprehensive dataset of Anacharis sequences worldwide and enabled us to connect European barcode data of A. eucharioides, A. petiolata and A. typica with that of Nearctic (mainly Canadian) records that are publicly available on BOLD. As the available data grows, along with continued revisionary work, the barcode datasets will become increasingly useful to accelerate the accumulation of life history and distribution knowledge about the species treated herein as well as of currently unknown species in Europe and worldwide.
Acknowledgements
The Federal Ministry of Education and Research of Germany (Bundesministerium für Bildung und Forschung, BMBF) is funding the project “GBOL III: Dark Taxa” as Research for Sustainable Development (Forschung für Nachhaltige Entwicklung, FONA; www.fona.de) under the funding reference 16LI1901A.
We sincerely appreciate the invaluable input from the reviews of Louis Nastasi and Simon van Noort that led to the final version of this manuscript.
We want to express our gratitude to Ximo Mengual, Tobias Salden and Santiago Jaume Schinkel for practical advice regarding the preparation of the male genitalia. Ximo Mengual proved most helpful for introducing and troubleshooting the camera setup. Juliane Vehof gave a comprehensive introduction into and was available for constant troubleshooting with the Zeiss imaging setup.
For the procession of the data into the GBOL and BOLD databases, we are indebted to the GBOL core team at the
We thank the administrative body and the research department of the Kellerwald Edersee National Park, in particular Carsten Morkel, for allowing the sampling with ten Malaise traps over a long period that yielded many interesting specimens.
We are grateful for the provision of samples by Andrius Petrašiūnas for the Lithuanian samples, Fons Verheyde, Augustijn de Ketelaere and Wouter Dekoninck for the Belgian and Dutch samples and Alf Tore Mjös for the Norwegian samples. We thank the staff of the Swedish Malaise Trap Project, Martti Koponen in Otava, Thorkhild Munk in Aarhus (+), and curators of several Swiss museums (Giulio Cuccodoro at
We want to thank Alexandra Popa (
We want to express our thanks for the support by Hege Vårdal (
We are grateful to Göran Nordlander and Matt Buffington for the continuous and exciting discussions about Cynipoid taxonomy and more.
We thank Santiago Jaume Schinkel and Fons Verheyde for testing the key and their precious comments that lead to its much-improved state.
For sharing her observations and images with us and allowing us to further share one of her images within this manuscript, we want to sincerely thank Kim Neubauer.
We are grateful to the International Society of Hymenopterists for their support.
References
- van Achterberg C, Shaw MR (2016) Revision of the Western Palaearctic species of Aleiodes Wesmael (Hymenoptera, Braconidae, Rogadinae). Part 1: Introduction, key to species groups, outlying distinctive species, and revisionary notes on some further species. ZooKeys 639: 1–164. https://doi.org/10.3897/zookeys.639.10893
- Aspöck H, Aspöck U, Hölzel H (1980) 1 Die Neuropteren Europas: Eine zusammenfassende Darstellung der Systematik, Ökologie und Chorologie der Neuropteroidea (Megaloptera, Raphidioptera, Planipennia) Europas. Goecke & Evers, Krefeld, 495 pp.
- Astrin JJ, Stüben PE (2008) Phylogeny in cryptic weevils: molecules, morphology and new genera of Western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate Systematics 22(5): 503–522. https://doi.org/10.1071/IS07057
- Awad J, Höcherl A, Hübner J, Jafari S, Moser M, Parsa M, Vogel J, Schmidt S, Krogmann L, Peters RS (2020) Just launched! GBOL III: Dark Taxa, a large research initiative focusing on German and Central European parasitoid wasps (and lower Diptera). Hamuli 11(2): 5–8.
- Baur H (2015) Pushing the limits – two new species of Pteromalus (Hymenoptera, Chalcidoidea, Pteromalidae) from Central Europe with remarkable morphology. ZooKeys 514: 43–72. https://doi.org/10.3897/zookeys.514.9910
- Baur H, Leuenberger C (2011) Analysis of ratios in multivariate morphometry. Systematic Biology 60(6): 813–825. https://doi.org/10.1093/sysbio/syr061
- Baur H, Leuenberger C (2020) Multivariate Ratio Analysis (MRA): R-scripts and tutorials
- for calculating Shape PCA, Ratio Spectra and LDA Ratio Extractor. https://doi.org/10.5281/ZENODO.4250142
- Buffington ML, Nylander JAA, Heraty JM (2007) The phylogeny and evolution of Figitidae (Hymenoptera: Cynipoidea). Cladistics 23(5): 403–431. https://doi.org/10.1111/j.1096-0031.2007.00153.x
- Buffington ML, Sandler RJ (2011) The Occurrence and Phylogenetic Implications of Wing Interference Patterns in Cynipoidea (Insecta: Hymenoptera). Invertebrate Systematics 25(6): 586. https://doi.org/10.1071/IS11038
- Buffington ML, Condon M (2013) The description and bionomics of Tropideucoila blepharoneurae Buffington and Condon, new species (Hymenoptera: Figitidae: Zaeucoilini), parasitoid of Blepharoneura Loew Fruit Flies (Tephritidae). Proceedings of the Entomological Society of Washington 115(4): 349–357. https://doi.org/10.4289/0013-8797.115.4.349
- Buffington ML, Forshage M (2014) The description of Garudella Buffington and Forshage, new genus (Hymenoptera: Figitidae: Eucoilinae). Proceedings of the Entomological Society of Washington 116(3): 225–242. https://doi.org/10.4289/0013-8797.116.3.225
- Buuren SV, Groothuis-Oudshoorn K (2011) mice: Multivariate Imputation by Chained Equations in R. Journal of Statistical Software 45(3): 1–67. https://doi.org/10.18637/jss.v045.i03
- Cameron P (1890) A monograph of the British phytophagous Hymenoptera (Tenthredo, Sirex
- and Cynips, Linné.) Vol. III. Ray Society, London, 341 pp.
- Cannet A, Simon-Chane C, Akhoundi M, Histace A, Romain O, Souchaud M, Jacob P, Delaunay P, Sereno D, Bousses P, Grebaut P, Geiger A, De Beer C, Kaba D, Sereno D (2022) Wing Interferential Patterns (WIPs) and machine learning, a step toward automatized tsetse (Glossina spp.) identification. Scientific Reports 12(1): 20086. https://doi.org/10.1038/s41598-022-24522-w
- Cannet A, Simon-Chane C, Akhoundi M, Histace A, Romain O, Souchaud M, Jacob P, Sereno D, Mouline K, Barnabe C, Lardeux F, Boussès P, Sereno D (2023) Deep learning and wing interferential patterns identify Anopheles species and discriminate amongst Gambiae complex species. Scientific Reports 13(1): 13895. https://doi.org/10.1038/s41598-023-41114-4
- Cave RD, Miller GL (1987) Notes on Anacharis melanoneura (Hymenoptera: Figitidae) and Charitopes mellicornis (Hymenoptera: Ichneumonidae) Parasitizing Micromus posticus (Neuroptera: Hemerobiidae). Entomological News 98(5): 211–216.
- Dalman JW (1823) Analecta entomologica. Typis Lindhianis, Holmiae, 104 pp. https://doi.org/10.5962/bhl.title.66069
- Dal Pos D, Mikó I, Talamas EJ, Vilhelmsen L, Sharanowski BJ (2023) A revised terminology for male genitalia in Hymenoptera (Insecta), with a special emphasis on Ichneumonoidea. PeerJ 11: e15874. https://doi.org/10.7717/peerj.15874
- von Dalla-Torre KW, Kieffer J-J (1910) Das Tierreich: Cynipidae. R. Friedländer und Sohn, Berlin. https://doi.org/10.5962/bhl.title.1077
- De Queiroz K (2007) Species concepts and species delimitation. Systematic Biology 56(6): 879–886. https://doi.org/10.1080/10635150701701083
- Dietz L, Eberle J, Mayer C, Kukowka S, Bohacz C, Baur H, Espeland M, Huber BA, Hutter C, Mengual X, Peters RS, Vences M, Wesener T, Willmott K, Misof B, Niehuis O, Ahrens D (2022) Standardized nuclear markers improve and homogenize species delimitation in Metazoa. Methods in Ecology and Evolution 14(2): 543–555. https://doi.org/10.1111/2041-210X.14041
- Edgar RC (2004) MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5(1): 113. https://doi.org/10.1186/1471-2105-5-113
- Fergusson NDM (1986) Handbook for the Identification of British Insects: Charipidae, Ibaliidae & Figitidae. Royal Entomological Society of London, London, 55 pp.
- Fontal-Cazalla FM, Buffington ML, Nordlander G, Liljeblad J, Ros-Farre P, Nieves-Aldrey JL, Pujade-Villar J, Ronquist F (2002) Phylogeny of the Eucoilinae (Hymenoptera: Cynipoidea: Figitidae). Cladistics 18(2): 154–199. https://doi.org/10.1111/j.1096-0031.2002.tb00147.x
- Haszprunar G, Eder J, Xylander W, Borsch T, Quandt D, Grobe P, Pietsch S, Geiger M, Astrin J, Rulik B, Hausmann A, Moriniere J, Holstein J, Krogmann L, Monje C, Traunspurger W, Hohberg K, Lehmitz R, Müller K, Nebel M, Hand R] (2011) GBOL. https://www.bolgermany.de
- Handlirsch A (1886) Die Metamorphose zweier Arten der Gattung Anacharis Dalm.
- Harris RA (1979) A glossary of surface sculpturing. Occasional Papers in Entomology 28: 1–31.
- Hausmann A, Krogmann L, Peters RS, Rduch V, Schmidt S (2020) GBOL III: DARK TAXA. iBOL Barcode Bulletin 10(1): 1–4. https://doi.org/10.21083/ibol.v10i1.6242
- Hawkes MF, Duffy E, Joag R, Skeats A, Radwan J, Wedell N, Sharma MD, Hosken DJ, Troscianko J (2019) Sexual selection drives the evolution of male wing interference patterns. Proceedings of the Royal Society B: Biological Sciences 286(1903): 20182850. https://doi.org/10.1098/rspb.2018.2850
- Hayat M (2009) Records and descriptions of Trichogrammatidae from India (Hymenoptera: Chalcidoidea). Oriental Insects 43(1): 201–227. https://doi.org/10.1080/00305316.2009.10417583
- Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the Ultrafast Bootstrap Approximation. Molecular Biology and Evolution 35(2): 518–522. https://doi.org/10.1093/molbev/msx281
- Hosseini F, Lotfalizadeh H, Norouzi M, Dadpour M (2019) Wing interference colours in Eurytoma (Hymenoptera: Eurytomidae): Variation in patterns among populations and sexes of five species. Systematics and Biodiversity 17(7): 679–689. https://doi.org/10.1080/14772000.2019.1687603
- ICZN [International Commission on Zoological Nomenclature] (1999) International Code of Zoological Nomenclature. 4th edn. The International Trust for Zoological Nomenclature, London.
- Ionescu MA (1969) Hymenoptera Cynipoidea. Fauna Republicii Socialiste Romania Vol. 9 Fasc. 6: 290 pp.
- Janšta P, Delvare G, Baur H, Wipfler B, Peters RS (2020) Data–rich description of a new genus of praying mantid egg parasitoids, Lasallegrion gen. n. (Hymenoptera: Torymidae: Podagrionini), with a re-examination of Podagrion species of Australia and New Caledonia. Journal of Natural History 54(9–12): 755–790. https://doi.org/10.1080/00222933.2020.1778112
- Jafari S, Müller B, Rulik B, Rduch V, Peters RS (2023) Another crack in the Dark Taxa wall: a custom DNA barcoding protocol for the species-rich and common Eurytomidae (Hymenoptera, Chalcidoidea). Biodiversity Data Journal 11: e101998: 1–13. https://doi.org/10.3897/BDJ.11.e101998
- Jin S, Parks KS, Janzen DH, Hallwachs W, Dyer LA, Whitfield JB (2023) The wing interference patterns (WIPs) of Parapanteles (Braconidae, Microgastrinae): demonstrating a powerful and accessible tool for species-level identification of small and clear winged insects. Journal of Hymenoptera Research 96: 967–982. https://doi.org/10.3897/jhr.96.111382
- Kapli P, Lutteropp S, Zhang J, Kobert K, Pavlidis P, Stamatakis A, Flouri T (2017) Multi-rate Poisson tree processes for single-locus species delimitation under maximum likelihood and Markov chain Monte Carlo. [Valencia A (Ed. )] Bioinformatics 33(11): 1630–1638. https://doi.org/10.1093/bioinformatics/btx025
- Katayama N, Abbott JK, Kjærandsen J, Takahashi Y, Svensson EI (2014) Sexual Selection on Wing Interference Patterns in Drosophila melanogaster. Proceedings of the National Academy of Sciences 111(42): 15144–15148. https://doi.org/10.1073/pnas.1407595111
- Kierych E (1984) Notes on the Genus Prosynapsis D.T. et Kieff. (Synapsis Forst.), with a List of Anacharis Dalm. Species Occurring in Poland (Hymenoptera, Cynipoidea, Anacharitidae). Annales Zoologici 37(11): 335–340.
- Markmann M, Tautz D (2005) Reverse taxonomy: an approach towards determining the diversity of meiobenthic organisms based on ribosomal RNA signature sequences. Philosophical Transactions of the Royal Society B: Biological Sciences 360(1462): 1917–1924. https://doi.org/10.1098/rstb.2005.1723
- Mata-Casanova N, Selfa J, Pujade-Villar J (2018) Three new species of Anacharis Dalman, 1823 (Hymenoptera: Figitidae), with revised taxonomy and distribution records of palaearctic and indomalayan species. European Journal of Taxonomy 414: 1–25. https://doi.org/10.5852/ejt.2018.414
- Mata-Casanova N, Selfa J, Wang Y, Chen X-X, Pujade-Villar J (2016) Diversity of subfamily Anacharitinae (Hymenoptera: Cynipoidea: Figitidae) in China with description of a new species of Xyalaspis Hartig, 1843. Journal of Asia-Pacific Entomology 19(1): 9–14. https://doi.org/10.1016/j.aspen.2015.11.007
- Meier R, Shiyang K, Vaidya G, Ng PKL (2006) DNA barcoding and taxonomy in diptera: A tale of high intraspecific variability and low identification success. [Hedin M (Ed. )] Systematic Biology 55(5): 715–728. https://doi.org/10.1080/10635150600969864
- Meier R, Blaimer BB, Buenaventura E, Hartop E, vonRintelen T, Srivathsan A, Yeo D (2022) A re-analysis of the data in Sharkey et al.’s (2021) minimalist revision reveals that BINs do not deserve names, but BOLD Systems needs a stronger commitment to open science. Cladistics 38: 264–275. https://doi.org/10.1111/cla.12489
- Mikó I, Masner L, Johannes E, Yoder MJ, Deans AR (2013) Male terminalia of Ceraphronoidea: morphological diversity in an otherwise monotonous taxon. Insect Systematics & Evolution 44(3–4): 261–347. https://doi.org/10.1163/1876312X-04402002
- Miller GL, Lambdin PL (1985) Observations on Anacharis melanoneura (Hymenoptera: Figitidae), a Parasite of Hemerobius stigma (Neuroptera: Hemerobiidae). Entomological News 96(3): 93–97.
- Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Von Haeseler A, Lanfear R (2020) IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Molecular Biology and Evolution 37(5): 1530–1534. https://doi.org/10.1093/molbev/msaa015
- Moser M, Ulmer JM, Van De Kamp T, Vasilița C, Renninger M, Mikó I, Krogmann L (2023) Surprising morphological diversity in ceraphronid wasps revealed by a distinctive new species of Aphanogmus (Hymenoptera: Ceraphronoidea). European Journal of Taxonomy 864: 146–166. https://doi.org/10.5852/ejt.2023.864.2095
- van Noort S, Buffington ML, Forshage M (2015) Afrotropical Cynipoidea (Hymenoptera). ZooKeys 494: 1–176. https://doi.org/10.3897/zookeys.493.6353
- Polaszek A, Fusu L, Viggiani G, Hall A, Hanson P, Polilov AA (2022) Revision of the World Species of Megaphragma Timberlake (Hymenoptera: Trichogrammatidae). Insects 13(6): 561. https://doi.org/10.3390/insects13060561
- Puillandre N, Brouillet S, Achaz G (2021) ASAP: assemble species by automatic partitioning. Molecular Ecology Resources 21(2): 609–620. https://doi.org/10.1111/1755-0998.13281
- Ratnasingham S, Hebert PDN (2007) Barcoding BOLD: The Barcode of Life Data System (www.barcodinglife.org). Molecular Ecology Notes 7(3): 355–364. https://doi.org/10.1111/j.1471-8286.2007.01678.x
- Ratnasingham S, Hebert PDN (2013) A DNA-Based Registry for All Animal Species: The Barcode Index Number (BIN) System. [Fontaneto D (Ed.)] PLoS ONE 8(7): e66213. https://doi.org/10.1371/journal.pone.0066213
- Reinhard H (1860) Die Figitiden des mittlern Europa. Berliner Entomologische Zeitschrift 4: 204–245.
- Ronquist F, Nordlander G (1989) Skeletal morphology of an archaic cynipoid, Ibalia rufipes (Hymenoptera: Ibaliidae). Entomologica Scandinavica Supplement No. 33: 1–62.
- Salden T, Peters RS (2023) Afrotropical Ceraphronoidea (Insecta: Hymenoptera) put back on the map with the description of 88 new species. European Journal of Taxonomy 884: 1–386. https://doi.org/10.5852/ejt.2023.884.2181
- Schulmeister S, Wheeler WC, Carpenter JM (2002) Simultaneous analysis of the basal lineages of Hymenoptera (Insecta) using sensitivity analysis. Cladistics 18(5): 455–484. https://doi.org/10.1111/j.1096-0031.2002.tb00287.x
- Shevtsova E, Hansson C (2011) Species recognition through wing interference patterns (WIPs) in Achrysocharoides Girault (Hymenoptera, Eulophidae) including two new species. ZooKeys 154: 9–30. https://doi.org/10.3897/zookeys.154.2158
- Shevtsova E, Hansson C, Janzen DH, Kjærandsen J (2011) Stable structural color patterns displayed on transparent insect wings. Proceedings of the National Academy of Sciences 108(2): 668–673. https://doi.org/10.1073/pnas.1017393108
- Stelzl M, Devetak D (1999) Neuroptera in agricultural ecosystems. Agriculture, Ecosystems and Environment 74(1–3): 305–321. https://doi.org/10.1016/S0167-8809(99)00040-7
- Thomson CG (1862) Försök Till Uppställning och Beskrifning af Sveriges Figiter. Öfversigt af Kongl. Vetenskaps-akademiens förhandlingar 18: 395–420.
- Trietsch C, Mikó I, Notton D, Deans A (2018) Unique extrication structure in a new megaspilid, Dendrocerus scutellaris Trietsch & Mikó (Hymenoptera: Megaspilidae). Biodiversity Data Journal 6: e22676. https://doi.org/10.3897/BDJ.6.e22676
- Verhandlungen Der Kaiserlich-Königlichen Zoologisch-Botanischen Gesellschaft in Wien 36: 235–238.
- Walker F (1835) Description of Some British Species of Anacharis. Entomological Magazine 2: 518–522.
- Weld LH (1952) Cynipoidea (Hym.) 1905–1950 Being a Supplement to the Dalla-Torre and Kieffer Monograph - the Cynipidae in Das Tierreich, Lieferung 24, 1910 and Bringing the Systematic Literature of the World up to Date, Including Keys to Families and Subfamilies and Lists of New Generic, Specific and Variety Names. Privately printed, Ann Arbor, Michigan, 351 pp.
- Westwood JO (1833) Notice of the habits of a cynipideous insect, parasitic upon the rose louse (Aphis rosae); with descriptions of several other parasitic hymenoptera. Magazine of Natural History 6: 491–497.
- Zetterstedt JW (1822) Resa genom Sweriges och Norriges lappmarker, förrättad år 1821. Berling, Lund, 1–2[: 266 + 232 pp].
- Zetterstedt JW (1838) pt. 2. In: Insecta Lapponica. Lipsiae [Leipzig], 220 pp.
- Žikić V, Van Achterberg C, Stanković SS, Ilić M (2011) The male genitalia in the subfamily Agathidinae (Hymenoptera: Braconidae): Morphological information of species on generic level. Zoologischer Anzeiger - A Journal of Comparative Zoology 250(3): 246–257. https://doi.org/10.1016/j.jcz.2011.04.006
Supplementary materials
Material examined
Data type: xlsx
Explanation note: Listing all material examined, including BOLD IDs if available. Was used as a basis for the material examined sections of each respective species. Contains all nine species.
Foreign BOLD IDs
Data type: xlsx
Explanation note: BOLD IDs of the sequences accessed via BOLD that were neither examined morphologically, nor produced herein.
Morphometry analysis: Raw data
Data type: xlsx
Explanation note: The raw data that was used to run the morphometric analyses, prior to the imputation script.
Imputed morphometric data
Data type: xlsx
Explanation note: The imputed morphometric data that was used for the morphometric analyses.
Additional results from morphometry
Data type: pdf
Explanation note: Documentation of additional results from morphometry: PCA and ratio extractor results of the species-level analyses not shown in the manuscript as well as the results of the allometry tests of all sspecies group- and species-level comparisons.