New host record of Doggerella chasanica (Hymenoptera, Braconidae, Braconinae) as a larval parasitoid of the serious forest pest Monochamus alternatus (Coleoptera, Cerambycidae) in Korea

Moo-Sung Kim; Il-Kwon Kim; Michael Sharkey; Ilgoo Kang

doi:10.3897/jhr.98.151974

Abstract

South Korea has been affected by pine wilt disease (PWD), with the vectors Monochamus alternatus Hope, 1842 and M. saltuarius Gebler, 1830 (Coleoptera: Cerambycidae) and PWD has expanded severely in southeastern South Korea since the late 2010s. In the pursuit of environmental-friendly pest management, we searched for potential natural enemies of M. alternatus. In 2019, we reared specimens of M. alternatus and confirmed that members of Doggerella (Lelejobracon) chasanica (Tobias, 2000) eclosed from them, for the first time. The average parasitism rate for D. (L.) chasanica was 4.2%, with a maximum parasitism rate of 5.9% in the sites investigated. Herein, we provide information on how we collected and reared M. alternatus along with a brief biological note, as well as re-description and a brief biological note of the parasitoid D. chasanica.

Keywords

Biology, COI DNA barcode, forest disease, invasive species, longhorn beetle, parasitoid, pine diseases

Introduction

Pine wilt disease (PWD) is caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus (Steiner and Buhrer 1934) and requires a vector for transmission, as the nematode is unable to move between pine trees on its own. The vectors of PWN belong to the genus Monochamus Dejean, 1821 (Coleoptera: Cerambycidae). Five species are recorded in East Asia (M. alternatus Hope, 1842, M. grandis Waterhaus, 1881, M. luxuriosus Bates, 1873, M. saltuarius Gebler, 1830, M. subfasciatus Bates, 1873) (Naves et al. 2005).

In South Korea, PWD was first reported from Busan in Korea in 1988 (Yi et al. 1989), and on Jeju Island in 2004 (Korea Forest Research Institute 2011). Two cerambycid species, M. alternatus and M. saltuarius, are known as the vectors of PWD. Particularly, M. alternatus is the more predominant vector of PWD on the Korea peninsula and the largest island in Korea, Jeju Island (Kwon et al. 2006). Pinus densiflora Siebold & Zucc., which occupies the largest forested area in South Korea and has been widely restored since the 1970s, serves as the main food source for M. alternatus (Choung et al. 2020). Given this, understanding tri-trophic interactions among P. densiflora, Monochamus spp., and parasitoids is crucial for reducing PWD.

Jeju Island is ecologically and geologically significant in Korea. As a volcanic island, it features a unique volcanic landscape and distinct flora and fauna, many species of which are endemic. Due to the importance, Jeju was designated as a UNESCO world natural heritage site in 2007 (UNESCO 2007). Despite ongoing management efforts, Jeju has continued to officially report damage caused by PWD (Korea Forest Service 2024). Researchers have been developing various ecologically sustainable methods to prevent and mitigate damage caused by PWD (Jeong et al. 2015; Park 2022). Among these, studies on the natural enemies of vectors have been conducted intermittently (Hong et al. 2008; Jang et al. 2019; Kim et al. 2022). Particularly in laboratory settings, Sclerodermus harmandi (Buysson, 1903) (Hymenoptera: Bethylidae) exhibited high oviposition and eclosion rates on larvae of M. saltuarius. For M. alternatus, the oviposition rate on host pupae was high but relatively low on larvae (Hong et al. 2008).

Our study confirmed that Doggerella (Lelejobracon) chasanica (Tobias, 2000) parasitizes M. alternatus immatures, representing a new host record for D. (L.) chasanica. This work presents the first investigation of natural enemies of M. alternatus on Jeju Island and describes the collecting and rearing methods used to find parasitoids. Additionally, we provide a brief biological note on M. alternatus and D. (L.) chasanica, contributing to the broader understanding of their ecological interactions.

Methods

Study sites and sessions

Three study sites comprising Pinus densiflora Siebold & Zucc. infested by PWD were selected for this research (Fig. 1). The detailed characteristics of the study sites and sessions are provided (Table 1). Considering the activity period of M. alternatus on Jeju Island (Kwon et al. 2019), we conducted three sessions at two-week intervals, from the fourth week of June to the third week of July in 2019. Fifteen sentinel logs per session were used in each site, and a total of 135 logs were employed throughout the experiment (Table 1).

Figure 1.

Three study sites affected by PWD on Jeju Island, South Korea.

Table 1.

Download as

CSV

XLSX

Detailed characteristics of the study sites (Jeju Island, South Korea).

Factor	Level
Location	Site 1 (33°26'21.05"N, 126°34'45.59"E)	Site 2 (33°19'25.28"N, 126°17'18.48"E)	Site 3 (33°19'7.92"N, 126°36'55.35"E)
Survey year	2019
Session	1^st (June 4^th wk), 2^nd (July 1^st wk), 3^rd (July 3^rd wk)
Forest type	Natural
Dominated tree species	P. densiflora
No. of used sentinel logs	M. alternatus: 135
DBH-class (cm)	18–28
Crown density	High
Age-class (year)	40‒50

Installation of sentinel log and rearing

Identifying the natural enemies of M. alternatus required height-specific surveys to locate parasitoids of its eggs or larvae. M. alternatus females primarily oviposit at approximately six meters on pine trees but can lay eggs at heights ranging from 0‒12 m (Futai et al. 1994). To account for this variation, we conducted field surveys and installed traps at different heights. The sentinel logs were installed following the method of Kim et al. (2022) (Fig. 2A). To install the logs, we utilized ropes (thickness: 5 mm), sandbags (weight: 340 g), and a slingshot (sling shot / length: 240 cm) to shoot the ropes over the branches in the tree canopy (Fig. 2B).

Figure 2.

Sentinel log installation process using a slingshot and rope in study site A preparation of sentinel logs that include eggs of M. alternatus with a rope to fix the sentinel logs B a rope tied to a sandbag to shoot up a pine tree branch with a slingshot C pulled the rope from the opposite side and installed at the desired height D after 2 weeks, dissection of sentinel logs using small knife in the laboratory.

Three P. densiflora trees were selected with a distance of 20 m between each tree. To investigate the preferred height of the natural enemies, we attached the sentinel logs to the rope using wire (thickness: 2 mm) at 2 m intervals (0, 2, 4, 6, and 8 m). We then pulled the ropes from the opposite side to install the sentinel logs at the desired heights (Fig. 2C). After two weeks, the sentinel logs were collected, and bark was peeled and dissected using a Swiss army knife in the lab to check whether M. alternatus larvae were parasitized. To prevent M. alternatus larvae and parasitoid larvae under the bark from dying, we removed the bark as gently as possible without damaging the larvae, ensured the logs remained moist during dissection, and minimized exposure to dry air (Fig. 2D).

Unparasitized M. alternatus larvae were separated and preserved in 99% ethanol, while parasitized M. alternatus larvae were transferred to small plastic cups (4.5∅ / 30 ml) and reared at room temperature (25 ± 1 °C) until they emerged as adults (Fig. 3A, B). Parasitoid larvae were observed daily, and their condition and eclosion dates were recorded.

Figure 3.

The process of identification of parasitized host larvae and rearing parasitoids in sentinel logs. A Debarking of sentinel logs to collect intact or parasitized host larvae B rearing parasitoids in small breeding cups.

Morphological analyses

Stereomicroscopes (Leica M205A Stereozoom & Leica S9E; Leica Microsystems, Solms, Germany) were used to examine specimens, and Leica M205A Stereozoom was used to capture images of the diagnostic characteristics of the parasitoids and the head capsules of parasitized M. alternatus larvae. LAS software (version 4.1.0, Leica Microsystems, Switzerland) was used for image stacking. Adobe Photoshop CS6 and Adobe Photoshop 2024 (Adobe Systems Incorporated, San Jose, United States of America) were used to edit stacked images and measure braconid morphometric characters. The head capsule width of M. alternatus larvae was measured to determine their instar stages, following Go et al. (2019). In the description of species, the numbers in parentheses represent the sizes of body parts, with mm as the unit of length. The morphological terms are based on Sharkey and Wharton (1997), and terminology for sculpturing follow Harris (1979).

Molecular analyses

Genomic DNA was extracted from legs or metasoma of parasitoid specimens using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany). Polymerase chain reaction (PCR) was performed, and the 658 bp fragment of the mitochondrial cytochrome c oxidase subunit I (COI) gene was targeted using the primer set LepF1 and LepR1 (Hebert et al. 2004). Each 25 µl PCR reaction contained 12.5 µl of DreamTaq Green PCR Master Mix (2X) (Thermo Scientific), 3 µl of template genomic DNA, 7.5 µl of ddH₂O, and 1.0 µl of each primer at a concentration of 10 µM. The PCR protocol consisted of an initial denaturation at 94 °C for 3 min, followed by 5 cycles of 94 °C for 30 s, 45 °C for 30 s, and 72 °C for 1 min; 35 additional cycles of 94 °C for 30 s, 51 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 7 min. Amplification success was confirmed by visualizing crude PCR products on 1.0% agarose gels. Purification and sequencing were conducted by Macrogen (Sejong, South Korea) using the 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Sequence data were processed via Geneious Prime 2025.0.1 (https://www.geneious.com). Primer regions were trimmed, and sequences were edited and assembled using de novo assembly. The final consensus sequence was generated by combining the sequences of multiple individuals, following the method of Sharkey et al. (2021).

Specimen information

The specimens used for this work will be deposited in the Korea National Arboretum (KNA).

Results

Parasitism of M. alternatus by D. (L.) chasanica and biological notes

Monochamus alternatus was confirmed as a new host record of Doggerella (Lelejobracon) chasanica from this study. Members of D. (L.) chasanica parasitize the 2^nd and 3^rd instar larvae of M. alternatus (average head width: 1.6 ± 0.3 mm), with an average parasitism rate of 4.2 % and a maximum parasitism rate of 5.9 % in the sites on Jeju Island in 2019 (Table 2). The parasitoid was confirmed to be a solitary ectoparasitoid, spinning a cocoon near remnants of the host larva after feeding. The pupal stage of D. (L.) chasanica was confirmed as 11.6 ± 1.9 days at 25 °C days on M. alternatus (Table 2). The members of M. alternatus exhibit the highest occurrence rate in Jeju Island between mid-June and early July, and D. (L.) chasanica was collected during this period as well. The braconid parasitoids were collected only at site 2 from mid-June to mid-July (session: 1^st and 2^nd). They parasitized D. (L.) chasanica at heights from 2 to 8 m (Table 2).

Table 2.

Download as

CSV

XLSX

Biological information of parasitoids from M. alternatus on Jeju Island.

Site	Session	Parasitoids #	Height of sentinel log	Head capsule size of M. alternatus (Laval instar)		Pupa period in 25 °C (day)		Parasitism rate (%) = (number of parastized host larvae / total number of host larvae) × 100		Sex of parasitoid
Site	Session	Parasitoids #	Height of sentinel log	Individuals	average	Individuals	average	Individuals	average	Sex of parasitoid
Site 2	1^st (June 4^th wk)	1	2 m	1.6 mm (3^rd)	1.6 ± 0.3	15	11.6 ± 1.9	5.9%	4.2%	Female
		2	2 m	1.5 mm (3^rd)		14
		3	6 m	1.1 mm (3^rd)		10
		4	4 m	1.2 mm (2^nd)		10
		5	8 m	1.7 mm (3^rd)		10
	2^nd (July 1^st wk)	6	6 m	1.9 mm (3^rd)		11		2.4%
	2^nd (July 1^st wk)	7	6 m	2.0 mm (3^rd)		11		2.4%

Taxonomy

Genus Doggerella Quicke, Mahmood & Papp, 2011

Doggerella Quicke, Mahmood & Papp, 2011: 2.

Type species.

Doggerella turneri Mahmood, Quicke & Papp, 2011.

Subgenus Lelejobracon Samartsev, 2016

Doggerella (Lelejobracon) chasanica in Samartsev, 2016: 124.

Type species.

Bracon chasanicus Tobias, 2000.

Doggerella (Lelejobracon) chasanica (Tobias, 2000)

Fig. 4A‒F

Bracon chasanicus Tobias, 2000, Belokobylskij and Tobias 2000: 148.

Doggerella (Lelejobracon) chasanica in Samartsev 2016: 124.

Bracon bitumor Papp, 2018: 26.

Bracon planitibiae Yang, Cao & Gould, 2019, in Cao et al. 2019: 430.

Doggerella (Lelejobracon) chasanica (Tobias, 2000), in Samartsev 2019: 54.

Doggerella (Lelejobracon) chasanica (Tobias, 2000), in Samartsev et al. 2024: 198.

Material examined.

Non-type South Korea • 5♀; Hangyeong-myeon, Jeju-si, Jeju-do, Korea; 33°19'25.28"N, 126°17'18.48"E; 17.VI.‒2.VII. 2019; Moo-Sung Kim (Korea National Arboretum) leg.; Host insect: Monochamus alternatus. • 2♀; Hangyeong-myeon, Jeju-si, Jeju-do, Korea; 33°19'25.28"N, 126°17'18.48"E; 1‒16.VII.2019; Moo-Sung Kim (Korea National Arboretum) leg.; Host insect: M. alternatus.

Diagnosis.

Samartsev (2016) transferred Bracon chasanicus Tobias, 2000 to Doggerella Quicke, Mahmood & Papp, 2011, establishing the subgenus Lelejobracon and recognizing D. (L.) chasanicaas the only Doggerella (Lelejobracon) species recorded from Russia. Later, Samartsev (2019) synonymized Bracon planitibiae Yang, Cao & Gould, 2019 and B. bitumor Papp, 2018 with D. (L.) chasanica. Regarding the subgenus, as discussed in detail by Samartsev (2016), Lelejobracon is easily distinguished from Doggerella s. str., which is restricted to the Afrotropical region, by its smooth and polished metasoma (Fig. 4C).

Figure 4.

Doggerella (Lelejobracon) chasanica, female, non-type, collected from Korea A lateral habitus B dorsal head, mesosoma, and tergum 1 C propodeum and metasoma D wings E anterior head F lateral mesosoma.

Molecular data.

The first COI DNA barcodes for Doggerella (Lelejobracon) chasanica were successfully obtained from specimens collected in Korea. The COI barcodes from two individuals were identical.

Consensus COI sequence (658 bp; GenBank accession numbers: PV169210, PV169211);

TATATTATATTTTTTTTTTGGTATTTGATCAGGAATTTTAGGTTTATCTATAAGAATAATTATTC GATTAGAATTAGGAATACCAGGAAGTTTATTAGGTAATGATCAAATTTATAATAGTATAGTAACTG CTCACGCATTTGTAATAATTTTTTTTATAGTTATACCAGTAATATTAGGTGGGTTTGGAAATTGAT TAATTCCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGAT TACTTATTCCTTCATTAATTTTATTAATTTTAAGAAGAATTTTAAATGTTGGTGTTGGAACTGGAT GAACAGTTTATCCTCCATTATCTTCTTCTTTAGGCCATAGAGGTATATCTGTTGATATAGCTATTT TTTCTTTACATTTAGCTGGAGCTTCATCAATTATAGGTTCAATTAATTTTATTACTACTATTTTTA ATATAAAATTAAATATTTTAAAATTAGATCAAATATCTTTGTTTATTTGATCAATTTTAATTACAA CAATTTTATTACTTTTATCTTTACCGGTATTAGCTGGTGCTATTACTATATTATTAACAGATCGAA ATTTTAATACATCATTTTTTGATTTTGCTGGTGGAGGAGATCCTGTTTTATTTCAACATTTATTT

Redescription.

The species was well-described by Samartsev (2016) and Samartsev et al. (2024). Most characters observed in the current study align with those described by Samartsev (2016) and Samartsev et al. (2024). However, we provide this redescription to include additional characters not mentioned in the previous studies and to provide a description with terminology that readers familiar with terminology used by Sharkey and Wharton (1997), particularly regarding wing vein terminology.

Body length 2.6 mm. Antenna length: 2.1 mm. Fore wing length 2.8 mm. Hind wing length 2.2 mm.

Head. Antenna with 24‒27 segments. 1^st flagellomere as long as 2^nd flagellomere (Fig. 4A, E). Vertex smooth and polished, sparsely setaceous (Fig. 4B). Frons entirely variolate. Face mostly variolate, width 1.5 × longer than its height (0.59:0.39). Anterior ocellus 0.7 × longer than distance between posterior ocelli (0.04:0.06). Eye sparsely setose; median width of eye 0.7 × longer than its height (0.24:0.35) in lateral view and 1.7 × longer than median width of gena in lateral view (0.24:0.14). Distance between anterior tentorial pits 0.15 mm. Hypoclypeal depression deep, 1.4 × longer than wide. Malar space 0.5 × longer than basal width of mandible (0.05:0.11) and 1/6 of eye height in anterior view (0.05:0.31).

Mesosoma. Mesosoma 1.5 × longer than maximum height in lateral view (1.08:0.7) (Fig. 4F). Mesoscutum entirely polished with long setae, basally punctate (Fig. 4B). Notauli weakly present, not meeting posteriorly (Fig. 4B). Scutellar sulcus straight, short, and finely crenulate. Scutellum entirely polished with long setae. Pronotum polished. Mesopleuron mostly smooth and polished; relatively bare medially (Fig. 4F). Metapleuron entirely with long setae (Fig. 4F). Propodeum entirely smooth and polished, anteriorly setose, 0.8 × longer than its maximum width (0.31:0.39).

Legs. Fore femur 0.7 × longer than fore tibia (0.34:0.48). Basal spur on fore tibia 0.5 × longer than fore basitarsus. Fore basitarsus 0.8 × longer than combined length of second to fourth tarsomeres (0.17:0.22). Mid tibia as long as mid femur (0.41:0.41). Basal spur on mid tibia 0.4 × longer than mid basitarsus (0.09:0.23). Mid basitarsus as long as combined length of second to fourth tarsomeres (0.23:0.24). Hind femur 0.8 × longer than fore tibia (0.6:0.8) Basal spur on hind tibia 0.4 × longer than hind basitarsus (0.11:0.3). Hind basitarsus 0.9 × longer than combined length of second to fourth tarsomeres (0.3:0.34).

Wings. Fore wing length 2.7 × longer than its width (2.82:1.05) (Fig. 4D). Pterostigma 3.2 × longer than its width (0.58:0.18). 1RS as long as (RS+M)b vein. (RS+M)b vein present, 0.2 × longer than 2RS (0.05:0.28). r 0.6 × longer than 2RS (0.16:0.28). 3RSa 1.8 × longer than r (0.29:0.16). 3RSb reaching wing margin as a tubular vein. r-m present as tubular vein medially. 2^nd submarginal cell trapezoid seemingly with two right angles apically (Fig. 4D). 3M reaching wing margin as a tubular vein. 3CU reaching wing margin as a tubular vein. Apical angle between mc-u and 2Cua approximately 120˚. Hind wing RS and M strongly developed, not reaching wing margin (Fig. 4D). M+CU 0.5 × longer than 1M (0.27:0.58). m-cu crossvein absent. cu-a entirely developed. 1A vein present not reaching wing margin.

Metasoma. Metasoma mostly polished and setose with long pale setae. Tergum 1 nearly rectangular (Fig. 4B); Y-shaped suture on tergum 1 present and crenulate (Fig. 4B); spiracle of tergum 1 located at basal third. Suture between tergum 2 and tergum 3 deep and finely granulose (Fig. 4C). Tergum 2 1.6 × longer than tergum 3 medially (0.34:0.22); spiracle of tergum 2 located at basal third. Setose part of ovipositor sheath as long as hind femur and 0.8 × longer than hind tibia (0.6:0.8). Ovipositor slightly curved.

Color. Body mostly polished black. Setae on body whitish to ivory. Antenna mostly dark brown; annellus brown. Face dorsomedially bright brown to yellow. Malar space brown. Mandibles mostly yellow. Wings mostly slightly infuscate. Pterostigma entirely brown. Legs mostly brown. Fore tarsus bright brown. Trochantelli mostly yellow. Tibial spurs yellow. Mesosternum mostly ivory. Ovipositor yellow.

Host insects.

Anoplophora glabripennis (Motschulsky, 1853), Monochamus alternatus Hope, 1842 (new host record).

Distribution.

China, Korea (GG, GN, Jeju (new record)), Russia (Far East).

Discussion

Doggerella (Lelejobracon) chasanica was first described as a new species of ectoparasitoid of larvae of Anoplophora glabripennis (Motschulsky, 1853) (Coleoptera: Cerambycidae) by Cao et al. (2019) from China. We report D. (L.) chasanica also attack larvae of Monochamus alternatus as an additional host insect. This discovery is particularly relevant, as it suggests that D. (L.) chasanica could be explored as a potential biological control agent against M. alternatus, and consequently, may help manage the spread of pine wilt disease in Korea. Given that A. glabripennis is another major pest species, the parasitoid’s ability to attack both M. alternatus and A. glabripennis enhances its potential as a biological control tool for invasive species. The discovery also implies that D. (L.) chasanica should be carefully evaluated before being considered as a viable biological control agent. Despite this broadened host range, the parasitoid still only targets two host species in China and Korea, limiting its current host range. This limited range, however, is a positive aspect for its consideration as a potential biological control agent. To assess its potential in controlling pest populations, further research is needed to understand its effectiveness across different environments and host species.

The parasitism rates against M. alternatus in Korea are highly similar to the parasitism rates against A. glabripennis investigated by Cao et al. (2019). Although the active season of D. (L.) chasanica overlaps with M. alternatus, from mid-June to early July, the parasitism rates of D. (L.) chasanica against M. alternatus were low, an average parasitism rate of 4.2 % and a maximum of 5.9 % in 2019. In Cao et al. (2019), female adults of D. (L.) chasanica parasitized first instar larvae of A. glabripennis, with an average parasitism rate of 4.0 % and a maximum of 5.9 %. These relatively low parasitism rates could indicate significant challenges when considering D. (L.) chasanica as a biological control agent. Low parasitism rates limit the effectiveness of parasitoid in controlling pest populations, particularly in large-scale infestations (Sint et al. 2016). This raises concerns about its ability to exert sufficient pressure on pest species, potentially limiting its role in biological control. To overcome this limitation, further studies are necessary to explore strategies for enhancing parasitism rates.

According to Harvey et al. (1999), various conditions affect parasitoid quality such as environmental conditions, host stages, and different host species. The pupal stage development times of D. (L.) chasanica varied depending not only on host species, M. alternatus and A. glabripennis. At 25 °C, the pupal stage of D. (L.) chasanica lasted 11.6 ± 1.9 days when parasitizing M. alternatus (Table 2) and 18‒20 days when attacking A. glabripennis (Cao et al. 2019). Despite the difference in host species, the development times of D. (L.) chasanica were shorter when later instar larvae were attacked. Although D. (L.) chasanica is an idiobiont ectoparasitoid, which typically have more consistent development times across host stages, the members of D. (L.) chasanica exhibit a similar pattern to the koinobiont endoparasitoid. Female adults of D. (L.) chasanica oviposited eggs on the second and third instar larvae of M. alternatus, A. glabripennis was attacked when it was in the first instar, which could contribute to its longer development time in comparison to M. alternatus. Harvey et al. (1999) found that the longest development time of Cotesia rubecula (Marshall, 1885) (Braconidae: Microgastrinae) was observed when the first instar larvae were used as hosts, with shorter development times when later instar larvae were parasitized when attacking the earliest instar host larvae of Pieris rapae (Linnaeus, 1758) (Lepidoptera: Pieridae). This finding further supports the potential influence of host stage on parasitoid development times. To assess the viability of D. (L.) chasanica as a biological control agent, future studies should investigate which host species are more appropriate for rearing higher quality parasitoids, as well as whether a longer immature stage would contribute to the production of superior parasitoids. Additionally, a comprehensive evaluation of the various factors influencing parasitoid quality is needed to determine the optimal conditions for D. (L.) chasanica as a biological control agent.

There was no significant variation in parasitism rates at the 6-meter height, which M. alternatus favors for oviposition (Table 2) (Futai et al. 1994), compared to other heights. This lack of variation may be due to an insufficient number of samples or parasitoid flight activity. Therefore, increasing the number of study sites and surveys is necessary to further investigate the ecology of D. (L.) chasanica in the field.

A. glabripennis, reported as a host for D. (L.) chasanica in China, is also found in Korea. However, D. (L.) chasanica has not been reported as a natural enemy of A. glabripennis in Korea (Hérard et al. 2006). The genetic differences between the Korean and Chinese populations of A. glabripennis could potentially explain the absence of this parasitoid-host interaction in the Korean population (Kim et al. 2019; Lee et al. 2020). Another species in Anoplophora, A. chinensis (Forster, 1771) (Coleoptera, Cerambycidae) is a well-known pest of citrus trees on Jeju Island, especially from July to August (Kim et al. 2000), and is also a serious invasive species in the U.S. (Hu et al. 2009). The biology and ecology of both A. glabripennis and A. chinensis are significantly similar. This suggests that D. (L.) chasanica could be a valuable biological control agent for A. chinensis, an agricultural pest in Korea, and A. chinensis, an invasive species.

In this study, we presented details on the collection and rearing of M. alternatus, along with a re-description and biological note on the parasitoid D. (L.) chasanica. This is the first report of D. (L.) chasanica as a natural enemy of M. alternatus larvae. Additionally, we discussed the potential use of D. (L.) chasanica as a natural enemy of A. chinensis, A. glabripennis and M. alternatus providing foundational data for future research on biological control of the three cerambycid pest species.

Acknowledgements

The authors thank Min Chul Kim (Korea National Arboretum) for his hard work as a research assistant. We also sincerely thank Dr Jasso-Martinez, the subject editor, and the reviewers for their valuable comments on our manuscript. We are especially grateful to Dr van Achterberg for carefully reviewing the manuscript and identifying important errors. This work was supported by grants from the Korea National Arboretum (project no. KNA1-1-20-16-1). In addition, this research was supported by Kyungpook National University Research Fund, 2023.

References

Cao LM, Wang XY, Gould JR, Li F, Zhang YL, Yang ZQ (2019) Bracon planitibiae sp. nov. (Hymenoptera: Braconidae), a new parasitoid of Asian longhorned beetle (Anoplophora glabripennis). Zootaxa 4671(3): 427–433. https://doi.org/10.11646/zootaxa.4671.3.8

Choung Y, Lee J, Cho S (2020) Review on the succession process of Pinus densiflora forests in South Korea: progressive and disturbance-driven succession. Journal of Ecology and Environment 44: 16. https://doi.org/10.1186/s41610-020-00157-8

Futai K, Shirakikawa S, Nakai I (1994) The suitability of Korean pine (Pinus koraiensis Sieb. et Zucc.) and Japanese Red Pine (P. densiflora Sieb. et Zucc.) as a host of the Japanese pine sawyer, Monochamus alternatus Hope (Coleoptera: Cerambycidae). Applied Entomology and Zoology 29(2): 167–177. https://doi.org/10.1303/aez.29.167

Geneious Prime (2025) Geneious Prime 2025.0.1. https://www.geneious.com

Go MS, Kwon SH, Kim SB, Kim DS (2019) The developmental characteristics for the head capsule width of Monochamus alternatus (Coleoptera: Cerambycidae) larvae and determination of the number of instars. Journal of Insect Science 19(1): 26. https://doi.org/10.1093/jisesa/iez010

Harris RA (1979) Glossary of surface sculpturing. Occasional Papers in Entomology 28: 1–31. https://doi.org/10.5281/zenodo.26215

Harvey JA, Jervis MA, Gols R, Jiang N, Vet LE (1999) Development of the parasitoid, Cotesia rubecula (Hymenoptera: Braconidae) in Pieris rapae and Pieris brassicae (Lepidoptera: Pieridae): Evidence for host regulation. Journal of Insect Physiology 45(2): 173–182. https://doi.org/10.1016/s0022-1910(98)00113-9

Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the Neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America 101(41): 14812–14817. https://doi.org/10.1073/pnas.0406166101

Hérard F, Ciampitti M, Maspero M, Krehan H, Benker U, Boegel C, Schrage R, Bouhot-Delduc L, Bialooki P (2006) Anoplophora species in Europe: Infestations and management processes 1. EPPO Bulletin 36(3): 470–474. https://doi.org/10.1111/j.1365-2338.2006.01046.x

Hong JI, Koh SH, Chung YJ, Shin SC, Kim GH, Choi KS (2008) Biological characteristics of Sclerodermus harmandi (Hymenoptera: Bethylidae) parasitized on cerambycid. Korean Journal of Applied Entomology 47(2): 133–139. https://doi.org/10.5656/KSAE.2008.47.2.133

Hu J, Angeli S, Schuetz S, Luo Y, Hajek AE (2009) Ecology and management of exotic and endemic Asian longhorned beetle Anoplophora glabripennis. Agricultural & Forest Entomology 11(4). https://doi.org/10.1111/j.1461-9563.2009.00443.x

Jang TW, Jeong JC, Choi JK, Jeong CS, Kim JK (2019) Biological characteristics of Dolichomitus cephalotes and Dolichomitus curticornis (Hymenoptera, Ichneumonidae), parasitoids of Monochamus saltuarius (Coleoptera, Cerambycidae). Journal of Forest and Environmental Science 35(4): 258–262. https://doi.org/10.7747/JFES.2019.35.4.258

Jeong MH, Yang SY, Lee YS, Ahn YS, Park YS, Han HR, Kim KY (2015) Selection and characterization of Bacillus licheniformis MH48 for the biocontrol of pine wood nematode (Bursaphelenchus xylophilus). Journal of Korean Society of Forest Science 104(3): 512–518. https://doi.org/10.14578/JKFS.2015.104.3.512

Kim DH, Kwon HM, Kim KS (2000) Current status of the occurrence of the insect pests in the citrus orchard in Cheju Island. Korean Journal of Applied Entomology 39(4): 267–274. http://entomology2.or.kr/journal/article.php?code=10708&Array

Kim MS, Kim KY, Lee W, Hong KJ (2019) Reporting the possibility of invasive populations of Anoplophora spp. in Korea. Journal of Asia-Pacific Biodiversity 12(2): 211–216. https://doi.org/10.1016/j.japb.2019.01.007

Kim MS, Jung JK, Hong KJ, Kim CJ, Lee BW, Kim IK (2022) Discovery and biology of Spathius verustus Chao (Hymenoptera: Braconidae), a potential biological agent on two Monochamus vectors of the pinewood nematode. Forests 13(6): 955. https://doi.org/10.3390/f13060955

Korea Forest Research Institute (2011) Report of monitoring for forest insect pests and diseases in Korea. Korea Forest Research Institute, Seoul, Korea.

Korea Forest Service (2024) The statistical yearbook of forestry. Korea Forest Service, Daejeon, Korea.

Kwon SH, Go MS, Park J, Han TW, Kim KB, Shin CH, Kim DS (2019) The bimodal adult activity of Monochamus alternatus (Coleoptera: Cerambycidae) caught in pheromone traps in Jeju can be explained by the competitive attractiveness of dying pine trees. Entomological Research 49(4): 172–178. https://doi.org/10.1111/1748-5967.12343

Kwon TS, Lim JH, Sim SJ, Kwon YD, Son SK, Lee KY, Kim YT, Park JW, Shin CH, Ryu SB, Lee CK, Shin SC, Chung YJ, Park YS (2006) Distribution patterns of Monochamus alternatus and M. saltuarius (Coleoptera: Cerambycidae) in Korea. Journal of Korean Society of Forest Science 95(5): 543–550.

Lee S, Lee Y, Lee S (2020) Population genetic structure of Anoplophora glabripennis in South Korea: Invasive populations in the native range? Journal of Pest Science 93(4): 1181–1196. https://doi.org/10.1007/s10340-020-01245-3

Mahmood K, Papp J, Quicke DL (2011) A new Afrotropical genus Doggerella gen. nov. of braconine wasp (Hymenoptera: Braconidae) with twelve new species. Zootaxa 2927(1): 1–37. https://doi.org/10.11646/zootaxa.2927.1.1

Naves P, Kenis M, Sousa E (2005) Parasitoids associated with Monochamus galloprovincialis (Oliv.) (Coleoptera: Cerambycidae) within the pine wilt nematode-affected zone in Portugal. Journal of Pest Science 78: 57–62. https://doi.org/10.1007/s10340-004-0068-z

Park IK (2022) Current status of pheromone research of forest insect pests in Korea and development direction. Korean Journal of Applied Entomology 61(1): 63–75. https://doi.org/10.5656/KSAE.2022.02.0.024

Samartsev KG (2016) A new subgenus of the genus Doggerella Quicke, Mahmood et Papp, 2011 (Hymenoptera: Braconidae: Braconinae) from the Russian Far East. Eurasian Entomological Journal [Евразиатский энтомологический журнал] 15(S1): 123–128.

Samartsev KG (2019) On the knowledge of the subfamily Braconinae (Hymenoptera: Braconidae) of Russia. Proceedings of the Russian Entomological Society [Труды Русского энтомологического общества]: 54–85. https://doi.org/10.47640/1605-7678_2019_90_54

Samartsev KG, Ku D-S, Lee H-R, Kwon G-M (2024) Braconidae: Braconinae. Insect Fauna of Korea. The National Institute of Biological Resources (Incheon, Republic of Korea): 13(15): 1–384. https://www.nibr.go.kr/aiibook/access/ecatalogt.jsp?callmode=admin&catimage=&eclang=ko&Dir=1327&um=s&start=4

Sharkey MJ, Wharton RA (1997) Morphology and terminology. In: Wharton RA, Marsh PM, Sharkey MJ (Eds) Manual of the New World genera of the family Braconidae (Hymenoptera). Special Publication of the International Society of Hymenopterists, No. 1, Washington, DC, 19–37.

Sharkey MJ, Baker A, McCluskey K, Smith A, Naik S, Ratnasingham S, Manjunath R, Perez K, Sones J, D’Souza M, Jacques BS, Hebert P, Hallwachs W, Janzen D (2021) Addendum to a minimalist revision of Costa Rican Braconidae: 28 new species and 23 host records. ZooKeys 1075: 77–136. https://doi.org/10.3897/zookeys.1075.72197

Tobias VI, Belokobylskij S (2000) 6. Subfamily Braconinae In: Lehr PA (Eds) Key to the insects of Russian Far East. Dal’nauka (Vladivostok, Russia) 4: 109–192.

Sint D, Sporleder M, Wallinger C, Zegarra O, Oehm J, Dangi N, Giri YP, Kroschel J, Traugott M (2016) A two-dimensional pooling approach towards efficient detection of parasitoid and pathogen DNA at low infestation rates. Methods in Ecology and Evolution 7: 1548–1557. https://doi.org/10.1111/2041-210X.12621

UNESCO (2007) Jeju Volcanic Island and Lava Tubes. https://whc.unesco.org/en/list/1264/

Yi CK, Byun BH, Park JD, Yang SI, Chang KH (1989) First finding of the pine wood nematode, Bursaphelenchus xylophilus (Steiner et Buhrer) Nickle and its insect vector in Korea.

﻿Abstract

Keywords

﻿Introduction

﻿Methods

﻿Study sites and sessions

﻿Installation of sentinel log and rearing

﻿Morphological analyses

﻿Molecular analyses

Specimen information

﻿Results

﻿Parasitism of M. alternatus by D. (L.) chasanica and biological notes

Taxonomy

﻿Genus Doggerella Quicke, Mahmood & Papp, 2011

Type species.

﻿Subgenus Lelejobracon Samartsev, 2016

Type species.

﻿ Doggerella (Lelejobracon) chasanica (Tobias, 2000)

Material examined.

Diagnosis.

Molecular data.

Redescription.

Host insects.

Distribution.

﻿Discussion

﻿Acknowledgements

﻿References

Abstract

Introduction

Methods

Study sites and sessions

Installation of sentinel log and rearing

Morphological analyses

Molecular analyses

Results

Parasitism of M. alternatus by D. (L.) chasanica and biological notes

Genus Doggerella Quicke, Mahmood & Papp, 2011

Subgenus Lelejobracon Samartsev, 2016

Doggerella (Lelejobracon) chasanica (Tobias, 2000)

Discussion

Acknowledgements

References