Research Article
Print
Research Article
Synonymy of Idiococcobius Hayat with Coccobius Ratzeburg (Hymenoptera, Aphelinidae): evidenced by a new species from Malaysian Borneo
expand article infoHui Geng‡, Cheng-De Li§, Jason Mottern|, Andrew Polaszek
‡ Shangrao Normal University, Shangrao, China
§ Northeast Forestry University, Harbin, China
| United States Dept Agriculture, Beltsville, United States of America
¶ Natural History Museum, London, United Kingdom

Corresponding author: Andrew Polaszek ( a.polaszek@nhm.ac.uk )

Academic editor: Petr Janšta
© 2020 Hui Geng, Cheng-De Li, Jason Mottern, Andrew Polaszek.
This is an open access article distributed under the terms of the CC0 Public Domain Dedication.
Citation: Geng H, Li C-D, Mottern J, Polaszek A (2020) Synonymy of Idiococcobius Hayat with Coccobius Ratzeburg (Hymenoptera, Aphelinidae): evidenced by a new species from Malaysian Borneo. Journal of Hymenoptera Research 78: 33-40. https://doi.org/10.3897/jhr.78.53064
ZooBank: urn:lsid:zoobank.org:pub:058EF85F-777D-4ED5-BFF2-B54B72E19E6A
Open Access

Abstract

Idiococcobius Hayat, syn. nov., is synonymised with Coccobius Ratzeburg, based on morphological and molecular data from a new species of Coccobius from Malaysian Borneo. The new species is sufficiently similar morphologically to the type species of Idiococcobius to place it unambiguously within that genus, but molecular data from the new species, and a reassessment of the morphology of Idiococcobius, indicate synonymy of the two genera. Idiococcobius encarsoides Hayat is therefore transferred to Coccobius; resulting in the new combination: Coccobius encarsoides (Hayat), comb. nov. Coccobius islandicus Geng & Polaszek, sp. nov, is described from morphology and DNA sequence data.

Keywords

chalcid wasps, Chalcidoidea, parasitoids, India, Malaysia, Sabah, taxonomy

Introduction

The genus Idiococcobius Hayat,2010 was described for an unusual species of aphelinid considered to be “extremely close to Coccobius…” (Hayat and Khan 2010), but to have affinity with some Encarsia species, hence the species name I. encarsoides Hayat, 2010. The morphological characters that purport to establish Idiococcobius as a valid genus also occur in a recently discovered new species from Malaysian Borneo. Molecular analysis of the latter species places it firmly within Coccobius. The affinities (and differences) between Coccobius encarsoides (Hayat) and Coccobius islandicus Geng & Polaszek, sp. nov., are detailed and discussed below.

Materials and methods

Morphological study

The single specimen of the new Coccobius species was collected in Sabah, Malaysian Borneo using a yellow pan trap. After “non-destructive” DNA extraction (see below), the specimen was dissected and mounted dorsally in Canada balsam on a slide following the method of Noyes (1982) with modifications for dealing with ProteinaseK processed specimens (AP, unpublished). Morphological terminology follows Hayat and Khan (2010).

Photographs were taken with a digital CCD camera attached to an Olympus BX63 compound microscope equipped with differential interference contrast. All measurements were taken from slide-mounted specimens. The holotype is deposited in the Natural History Museum, London, UK

The following abbreviation is used:

NHMUK Natural History Museum, SW7 5BD, London, UK

DNA sequencing

Genomic DNA extraction was undertaken using the protocol in Polaszek et al. (2013), which leaves the sclerotized parts of the specimen intact. The specimen was then mounted in Canada balsam on a microscope slide (see above). Primer sequences are given in Table 1. A total of 25μl per reaction with 2.5μl 10× NH4 Reaction Buffer, 1.5μl 50mM MgCl2 Solution, 0.5μl dNTP’s, 1μl of each primer, 0.5μl BIOTAQ DNA Polymerase, and 6μl DNA template. PCR amplifications included a pre-cycle denaturation step for 5 min at 94 °C and a final post-cycle extension step at 72 °C for 5 min (Table 1).

Table 1.
Download as
CSV
XLSX

Primer sequences and cycling conditions.

Primer sequence Cycling conditions
Denaturation Annealing Extension Cycles
COI (Hajibabaei et al. 2006)
MLepF1 5’ GCTTTCCCACGAATAAATAATA3’ 94 °C 50 °C 72 °C 40
LepR1 5’ TAAACTTCTGGATGTCCAAAAAATCA 3’ (30 sec) (30 sec) (1 min)
28S-D2 (Park and O’Foighil 2000)
D23f 5’ GAGAGTTCAAGAGTACGTG 3’ 94 °C 50°C 72 °C 40
28Sb 5’ TCGGAAGGAACCAGCTACTA 3’ (30 sec) (30 sec) (1 min)

DNA was sequenced at the Natural History Museum Life Sciences DNA Sequencing Facility (London) using the same primers used for the PCR. Forward and reverse sequences were assembled and corrected using Sequencher version 4.8. The 28S sequence of Coccobius islandicus Geng & Polaszek, sp.nov., has been deposited in GenBank under accession no MT350291. The resulting COI sequence was short, and not useful for comparative analysis. However, a 28S D2 sequence of 744bp was obtained and sent (including the trace file) to the 3rd author (JM) for comparison and analysis with his substantial database of 147 Coccobius DNA sequences.

The 28S sequence from C. islandicus was incorporated into a larger molecular dataset (JM in-prep; data not shown) that included an encyrtid outgroup (four terminals, from the genera Anagyrus, Encyrtus, Metaphycus, and Oobius), non-Coccobius coccophagine aphelinids (20 terminals, from the genera Bardylis, Coccophagoides, Coccophagus, Dirphys, Encarsia, Euxanthellus, and Pteroptrix), and 147 Coccobius terminals representing specimens from all biogeographic regions where Coccobius are known. Ribosomal DNA sequences were aligned using the E-INS-I algorithm in Mafft v6 (Katoh et al. 2009) with default settings. Ribosomal and mitochondrial genes were then concatenated using SequenceMatrix v.100.0 (Vaidya et al. 2010) for a final alignment length of 3153 base pairs. Maximum likelihood (ML) analysis of the concatenated alignment was conducted using RAxML v8.2.12 (Stamatakis 2014) under a GTR+Γ substitution model as implemented through the CIPRES Web Portal (Miller et al. 2010) accessed at http://www.phylo.org/. The data were analyzed with 1000 rapid bootstraps using five gene partitions: 18S, 28S-D2, 28SD3-5, COI codon positions 1 and 2, and COI codon position 3. Only the 28S sequence from C. islandicus aligned with the existing dataset, so only its 28S sequence is included in the analysis. The resulting best tree (highest likelihood) was visualized using FigTree v1.4.3 (Rambaut 2009).

Results

Morphology

C. islandicus Geng & Polaszek, sp. nov., shares a number of apparent synapomorphies with C. encarsoides (Hayat) as follows: pronotum medially membranous; mid lobe of mesoscutum with a reduced number of setae arranged bilaterally; fore wing narrow with very long marginal fringe (more than 2/3 the maximum wing width); submarginal vein with a single seta. These characters, not previously encountered in described Coccobius species, clearly indicate that the two species are closely related.

The morphological differences between the two species, tabulated below, strongly support recognition of C. islandicus as a new species.

Table 2.
Download as
CSV
XLSX

Differences between C. islandicus (Geng & Polaszek) and C. encarsoides (Hayat).

C. islandicus (Malaysia) C. encarsoides (India)
colour of body pronotum brown, lateral metasoma with brown patches; remainder pale. body largely pale yellow, appearing translucent white after cleaning and mounting except pronotum in anterior half pale brown
colour of antenna F1 and club brown; remainder white. entirely white
colour of legs fore and mid tibiae pale brown, hind femora and tibiae brown; remainder white. white
ovipositor/mid tibia 1.21 1.49
third valvula/ovipositor 0.27 0.23
mid tibial spur/ mid basitarsus 1.29 1.12
fore wing length/ width 3.22 4.4
fore wing marginal fringe/width 0.68 slightly shorter
setae on mid lobe of mesoscutum 8 12
setae on TII of metasoma 1+1 2+2
sensilla on stigmal vein in a close group of 4 in 2 separated groups of 2

Molecular analysis

The analysis of the 28S D2 sequence of C. islandicus together with 147 Coccobius sequences representing at least 125 species unequivocally demonstrates that this species, and by extrapolation therefore Idiococcobius, are nested deeply within Coccobius and do not represent a distinct genus. Idiococcobius Hayat is therefore here synonymized with Coccobius Ratzeburg, syn. nov. Idiococcobius encarsoides Hayat is here transferred to Coccobius encarsoides (Hayat), comb. nov. C. islandicus clusters with other Australian / SE Asian species. Its sister species (with low bootstrap support) is from Singapore.

Taxonomy

Coccobius islandicus Geng & Polaszek, sp. nov.

http://zoobank.org/EE1EE627-07A5-4DFD-B7C1-CB70AD20A853
Figs 1 A–C, 2 A, B

Material examined

Holotype ♀ (on slide): 21–25 Aug 2016, MALAYSIA: Sabah (N. Borneo), Keningau, Jungle Girl Camp, 5°26'55.7"N, 116°27'08.6"E, rainforest. H. Geng; NHMUK; specimen ID: GH025-92

Diagnosis

Antennal F1 and clava brown (Fig. 1B). Pronotum medially membranous; mid lobe of mesoscutum with 8 setae (Fig. 2A); maximum length of marginal fringe of fore wing 0.68× wing width.

Figure 1. 

Coccobius islandicus Geng & Polaszek, sp. nov. A head B antenna C wings. Scale bars: 50 μm.

Description (female holotype)

Length 0.60 mm.

Colour. Head brown, frons paler. Mandibles very dark, especially toward apices (Fig. 1A). Antenna pale, F1 and clava brown (Fig. 1B). Pronotum and anterior margin of mesoscutal mid lobe brown, remainder of body largely pale, but brown laterally. Fore and mid tibiae pale brown, hind femora and tibiae brown (Fig. 2B). Wings hyaline except tegula pale brown(Fig. 1C).

Morphology. Head 1.5 times as broad as frontovertex width (Fig. 1A), frontovertex width less than length of clava (0.74). Upper margins of antennal toruli slightly below lower eye margins. Eye setose. Antennal radicle long, 0.37× scape length. Pedicel just over 0.5× scape length, 1.56× length F1. F1 as long as F2, 0.78× F3. Clava slightly longer than funicle. Antennomeres with the following numbers of sensilla: F1:0; F2:1; F3:2; C1:3; C2:5.

Mid lobe of mesoscutum with 8 setae arranged in approximate bilateral symmetry. Sculpture of mesoscutal mid lobe consisting of large irregular reticulations, that of scutellum with longitudinal elements. Scutellum with 2+2 setae, the front pair placed slightly behind the level of the scutellar sensilla (Fig. 2A). Wings elongate. Fore wing 3.22× as long as wide, marginal fringe 0.68× as long as maximum wing width, submarginal vein with 1 seta, stigmal vein sensilla in a cluster of 4 (Fig. 1C). Hind wing 7× as long as wide, marginal fringe 1.6× as long as maximum wing width. Mid tibial spur 1.29× mid basitarsus.

Metasomal setation: T1: 0+0; T2:1+1; T3-T5: 2+2; T6:4; T7:6. Ovipositor length 1.21× mid tibia; 3rd valvula 0.27× ovipositor (Fig. 2B).

Figure 2. 

Coccobius islandicus Geng & Polaszek, sp. nov. A mesosoma B mesosoma- and metasoma. Scale bars: 50 μm.

Male

Unknown.

Host

Unknown.

Distribution

Sabah, Malaysian Borneo.

Etymology

”island”-(icus) is the latinised form of the English word “Iceland”, in this case referring to a British food retailer that has banned the use of palm oil in its products. The species name does not imply any endorsement by the authors of this retailer's products.

Discussion

Hayat (in Hayat and Khan 2010) described Idiococcobius as a genus he considered to be close to, but distinct from, Coccobius, based on a combination of characters that had not previously been encountered in any Coccobius species known to him at that time. The medially membranous pronotum, reduced and bilaterally symmetrical mesoscutal setae, and narrow fore wing with long marginal fringe, all suggested possible affinity with Encarsia, a genus not particularly close to Coccobius. These characters clearly merited the description of a new genus, with the Encarsia similarities conveyed in the species name “encarsoides”. These kinds of reduction characters appear to be common not only across the Aphelinidae, but among many chalcids and beyond. Setal reduction and wing narrowing (as seen here), reduction in tarsal segment number and antennomeres are all processes known to have occurred independently in multiple lineages, and have confounded traditional morphology-based taxonomy for so long. The development of relatively comprehensive molecular databases, even those (as herein) relying on a single gene, are extremely valuable for the unequivocal elucidation of an organism’s true relationships. While not always perfect, when sample size is adequate and gene variability sufficient, their predictive power is considerable. Studies such as that described above are able both to contribute towards more stable classification as well as reveal widespread morphological convergence, especially in organisms with similar biology.

Acknowledgements

This project was supported by the National Natural Science Foundation of China (Grant No. 31470652), the Doctoral Scientific Research Foundation of Shangrao Normal University (Grant No. 6000157), the Science and technology project of Education Department of Jiangxi province (Grant No. GJJ180883).Hui Geng would like to acknowledge the help of Mr Rahim Sulaiman, former Deputy Chief Conservator of Forests, Sabah Forestry Department, for facilitating access to the type locality of C. islandicus.

The paper benefited greatly from reviews by Prof. Jim Woolley and Dr Stefan Schmidt.

References

  • Hajibabaei M, Janzen DH, Burns JM, Hallwachs W, Hebert PD (2006) DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Sciences of the United States of America 103: 968–971. https://doi.org/10.1073/pnas.0510466103
  • Hayat M, Khan FR (2010) Additions to the Aphelinidae of India (Hymenoptera–Chalcidoidea): 1. On species of Ablerus Howard, Coccobius Ratzeburg, Coccophagus Westwood, Pteroptrix Westwood, and Idiococcobius Hayat gen. nov. Colemania 21: 1–31.
  • Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the Neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America 101: 14812–14817. https://doi.org/10.1073/pnas.0406166101
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans (Louisiana), 14 November 2010, 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Park J-K, Foighil DÓ (2000) Sphaeriid and Corbiculid Clams Represent Separate Heterodont Bivalve Radiations into Freshwater Environments. Molecular Phylogenetics and Evolution 14: 75–88. https://doi.org/10.1006/mpev.1999.0691
  • Polaszek A, Ayshford T, Yahya BE, Fusu L (2013) Wallaceaphytis: an unusual new genus of parasitoid wasp (Hymenoptera: Aphelinidae) from Borneo. Journal of Natural History Wallace 100 centenary: 6–7.
login to comment