Research Article
Print
Research Article
Resurrection of Neocardiochiles Szépligeti, 1908 (Hymenoptera, Braconidae, Cardiochilinae) with descriptions of five new species from the Neotropical region
expand article infoIlgoo Kang‡, James B. Whitfield§, Brittany E. Owens‡, Junyan Chen‡
‡ Louisiana State University, Baton Rouge, United States of America
§ University of Illinois at Urbana-Champaign, Urbana, United States of America

Corresponding author: Ilgoo Kang ( ikang1@lsu.edu )

Academic editor: Jose Fernandez-Triana
© 2022 Ilgoo Kang, James B. Whitfield, Brittany E. Owens, Junyan Chen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Kang I, Whitfield JB, Owens BE, Chen J (2022) Resurrection of Neocardiochiles Szépligeti, 1908 (Hymenoptera, Braconidae, Cardiochilinae) with descriptions of five new species from the Neotropical region. Journal of Hymenoptera Research 91: 41-68. https://doi.org/10.3897/jhr.91.84937
ZooBank: urn:lsid:zoobank.org:pub:410351D0-DE45-4C43-A31E-35DC8DB55B62
Open Access

Abstract

Neocardiochiles Szépligeti, 1908, is a rare Neotropical genus of the subfamily Cardiochilinae Ashmead, 1900. The genus was previously synonymized with Heteropteron Brullé, 1846 by Dangerfield et al. (1999). In this study, we examined multiple specimens of Heteropteron-related genera: Heteropteron, Neocardiochiles, and Wesmaelella Spinola, 1851, and resurrect Neocardiochiles as a valid genus based on morphological data. As a result, five new species, N. alexeyi Kang, sp. nov. from Ecuador, N. franki Kang, sp. nov. from Costa Rica, N. braeti Kang, sp. nov., N. chriscarltoni Kang, sp. nov., and N. victoriae Kang, sp. nov., from French Guiana are included as members of Neocardiochiles and described based on morphological and molecular data. Additionally, four species previously included in Heteropteron are transferred to Neocardiochiles: Neocardiochiles fasciipennis Szépligeti, 1908, comb. nov., Neocardiochiles hasegawai (Dabek & Whitfield, 2020) comb. nov., Neocardiochiles kidonoi (Dabek & Whitfield, 2020), comb. nov., and Neocardiochiles whitfieldi (Mercado, 2003), comb. nov.. Diagnosis of each taxon and both traditional and interactive identification keys to Neocardiochiles species are included. Molecular data of N. alexeyi sp. nov., N. chriscarltoni sp. nov., N. victoriae sp. nov., and N. hasegawaii (Dabek & Whitfield, 2020), are also provided.

Keywords

Delta, DNA, Intkey, parasitoid wasps, phylogeny, taxonomy, 16S rRNA, 28S rRNA

Introduction

Members of the cardiochiline genera, Heteropteron Brullé, 1846, Neocardiochiles Szépligeti, 1908 and Wesmaelella Spinola, 1851 are rarely-collected braconid wasps in the Neotropical region, which possess a relatively large body size (6.5–13 mm). These three genera have been treated as the most plesiotypic members of the Cardiochilinae Ashmead, 1900 based on morphological characters (Dangerfield et al. 1999). Heteropteron was confirmed as an early-diverging genus based on molecular data (Murphy et al. 2008). Prior to the current publication, only seven species were recorded from the three genera, including two recently described species: N. hasegawai (Dabek & Whitfield, 2020), comb. nov. and N. kidonoi (Dabek & Whitfield, 2020), comb. nov.. Detailed biological information for these two species was collected by Drs Daniel Janzen and Winnie Hallwachs and their team members at the Area de Conservación Guanacaste (ACG) (Dabek et al. 2020).

Despite the rarity of the specimens of the three genera in museum collections, their relationships have been frequently discussed and have fluctuated even in recent decades (Dabek et al. 2020). All three genera were considered valid by Whitfield and Dangerfield (1997), but Dangerfield et al. (1999) later subsumed Neocardiochiles and Wesmaelella into Heteropteron. Mercado and Wharton (2003) partly agreed with these synonymies, resurrecting Wesmaelella as a valid genus while retaining Neocardiochiles as a junior synonym of Heteropteron based on wing venation. Papp (2014) and Dabek et al. (2020) further validated separation of Heteropteron and Wesmaelella before the current study. Herein, we resurrect Neocardiochiles as a valid genus based on a morphological analysis of previously recorded and new species. In addition, both traditional and interactive keys to species of Neocardiochiles are given for identification, and molecular data for four species of Neocardiochiles are included.

Materials and methods

Specimen information

The type specimens of recorded species for this work were borrowed from the Hungarian Natural History Museum (HMNH; Budapest, Hungary), and a type specimen of N. whitfieldi (Mercado, 2003), comb. nov. was examined at the Texas A&M University Insect Collection (TAMU; College Station, Texas, USA) by the first author. Two non-type specimens of N. kidonoi and N. hasegawai reared at ACG were also included and examined. Other specimens were provided by the Hymenoptera Institute (HIC; 116 Franklin Ave., Redlands, California, USA), Illinois Natural History Survey (INHS; Champaign, Illinois, USA), University of Wyoming Insects Museum, (Laramie, Wyoming, USA), and Mr Yves Braet’s private collection. Holotypes of new species will be deposited in Canadian National Collection of Insects (CNC; Ottawa, Ontario, Canada), UWIM, and the Royal Belgian Institute of Natural Sciences (RBINS; Brussels, Belgium).

Morphological analyses

A Leica MZ75 stereomicroscope was used to examine specimens. The morphological terms are mostly based on Dangerfield et al. (1999) and Sharkey and Wharton (1997). Terms for sculpturing follow Harris (1979). The following acronyms are used throughout: POL (distance between posterior ocelli), T1 (first metasomal tergum), T2 (second metasomal tergum), and T3 (third metasomal tergum). Color images were taken using a Visionary Digital BK Plus imaging system (Dun, Inc.) equipped with a Canon EOS 5DS DSLR. Captured images were stacked via Zerene Stacker v.1.04 (Zerene Systems LLC.), and stacked images were edited in Adobe Photoshop CS 6 and Photoshop CC 2022 v. 23.0 (Adobe Systems, Inc). Image plates were produced using Photoshop CC 2022 v. 23.0. Using the Atlas of Living Australia (ALA) version of DELTA Editor (Open DELTA 1.02 beta) (Dallwitz et al. 1999), morphological characters of the members of Neocardiochiles were recorded, and an interactive key was generated. The interactive key was tested using Intkey (Dallwitz et al. 2000). Morphometric characters were measured via the same Adobe software. The numbers in parentheses in species descriptions indicate the actual size of body parts, and the unit of length is mm.

Molecular analyses

DNA was extracted from one to two legs of each specimen using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany). Mitochondrial 16S rRNA (16S), and nuclear 28S rRNA (28S) genes were targeted and amplified using the primers listed in Table 1. PCR reaction volumes were 25 ul containing 12.5 ul of DreamTaq Green PCR Master Mix (2X) (Thermo Scientific), 1–2 ul of template genomic DNA, 9.5 ul of ddH2O, and 1.0 ul of each primer at 5–10 uM. PCR conditions were 95 °C for 3 min; 40 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min; and a final extension at 72 °C for 7 min for 16S. For 28S, we followed Smith et al. (2008), but reduced the cycle number from 35 to 30. PCR products were visualized on a 1.8–2.0% agarose gel to confirm the success of amplification. PCR products were initially cleaned by a EtOH clean-up method and sequenced on the 3130xl Genetic Analyzers (Applied Biosystems) using the BigDye Terminator v1.1 chemistry (Applied Biosystems) at the LSU Genomics Facility. DNA assembly and sequence editing were conducted using Geneious Prime 2021.2 (https://www.geneious.com). Edited sequences of 16S and 28S were aligned using MUltiple Sequence Comparison (MUSCLE) (Edgar 2004) on the website of EMBL’s European Bioinformatics Institute (https://www.ebi.ac.uk/Tools/msa/muscle/) (Madeira et al. 2019) with a default setting. Genetic distances were estimated using MEGA11 (Tamura et al. 2021). The estimates were performed with a Kimura-2-parameter model (K2P) with pairwise deletion for the gaps/missing data treatment.

Table 1.
Download as
CSV
XLSX

Information for genes and primers used in the current study.

Target genes Primer sequences (5’→3’) References
16S rRNA cacctgtttatcaaaaacat (F) Dowton and Austin (1994)
cttaattcaacatcgaggtc (R) Chen et al. (2006)
28S rRNA agagagagttcaagagtacgtg (F) Belshaw and Quicke (1997)
ttggtccgtgtttcaagacgg (R) Campbell et al. (2000)
tagttcaccatctttcgggtc (R) Belshaw et al. (2001)

Phylogenetic analyses

Morphological data

Thirty-nine morphological characters for ten Neocardiochiles species were selected and included in the phylogenetic analysis (Table 2). Ten characters (as indicated in the table) were based on or modified from Dangerfield et al. (1999). Additionally, 29 new informative characters were discovered and included in the analysis. Characters were coded from females except for N. whitfieldi (Mercado, 2003), comb. nov., which is known only from a male specimen. Among 39 characters, 32 characters were coded as binary states and seven were coded as multistate characters (Table 2). To reduce errors in the parsimony analysis, continuous characters were coded as discrete binary or multistates. The character matrix for a phylogenetic analysis was prepared using Mesquite version 3.70 (Maddison and Maddison 2021). In the matrix ‘?’ indicates character states that were not coded because those characters were absent on specimens (Suppl. material 4). Using this matrix, a maximum parsimony (MP) analysis was performed using PAUP* (Swofford 2021). Heuristic searches were conducted via multiple TBR + TBR hold. All character states were unweighted and unordered. The tree was rooted using Protomicroplitis calliptera (Say, 1836) (Braconidae: Microgastrinae) as the outgroup. A list of apomorphic characters was produced using PAUP* and mapped on the MP phylogeny using Adobe Acrobat Pro DC (Adobe Systems, Inc) (Fig. 1).

Figure 1. 

Maximum Parsimony (MP) phylogeny based on morphological data indicating the relationships of Heteropteron, Neocardiochiles and Wesmaelella. Protomicroplitis calliptera (Hymenoptera: Braconidae: Microgastrinae) is included as the outgroup. Synapomorphies are mapped on the phylogeny. Black bars indicate non-homoplastic characters, and white bars represent homoplastic characters. Characters are listed above bars, and character states are indicated below bars.

Table 2.
Download as
CSV
XLSX

List of characters and character states used in the data matrix.

Number Characters Character states
1 Y-shaped suture on frons absent = 1; present = 2
2 POD broad = 1; narrow = 2
3 Malar space width as long as basal width of mandible = 1; shorter than basal width of mandible = 2
4* Mouthparts length short = 1; elongate = 2
5 3rd maxillary palpi shape moderately swollen apically in lateral view = 1; strongly swollen apically in lateral view = 2
6 Scutellar sulcus shape transversely straight = 1; transversely curved = 2
7 Scutellar sulcus depth shallow and evenly impressed = 1; medially shallow, laterally deep = 2
8 Scutellum length longer than basal width of scutellum = 1; shorter than basal width of scutellum = 2
9 Metascutellum length long = 1; short = 2
10 Posterior margin of axilla meeting lateral margin of scutellum with narrow angle = 1; meeting lateral margin of scutellum with broad angle = 2
11 Pronotal carina absent = 1; present = 2
12 Episternal scrobe apparent = 1; weakly impressed = 2
13 Ventral margin of metapleuron without carinate margin = 1; anteriorly carinate = 2; entirely carinate = 3
14* Median longitudinal furrow on propodeum absent = 1; present = 2
15 Curved submedial carina on propodeum absent = 1; present posteriorly = 2
16 Lateral margin of propodeum absent = 1; carinate = 2
17* Fore wing 1r present = 1; absent = 2
18 Fore wing 2RS shape angled = 1; basally weakly curved = 2; straight = 3
19* Fore wing 3RSb broken basally = 1; evenly present = 2
20 Fore wing (RS+M)b length shorter than m-cu = 1; longer than m-cu = 2
21 Fore wing (RS+M)b angle meeting 2M with ~140° = 1; meeting 2M with 180° = 2
22 Fore wing RS2 present as basal stump = 1; absent = 2
23 Fore wing r-m length 0.5 × longer than height of second submarginal cell = 1; 0.3 × longer than height of second submarginal cell = 2; as long as height of second submarginal cell = 3
24 Fore wing 1cu-a origin arising from middle of 1CU = 1; arising from basal fourth of 1CU = 2
25* Fore wing 1a absent = 1; present = 2
26 Hind wing M+CU length slightly longer than 1M = 1; shorter than 1M = 2; as long as 1M = 3
27 Hind wing cu-a length as long as 1M = 1; shorter than 1M = 2
28* Hind wing 2-1A length reaching at basal half = 1; not reaching at basal half = 2
29 Second tarsomere of fore leg length shorter than fifth tarsomere = 1; as long as fifth tarsomere = 2
30 Second tarsomere of middle leg length shorter than combined length of third and fourth tarsomeres = 1; longer than combined length of third and fourth tarsomeres = 2
31 Basal spur on hind tibia length ~0.33 × longer than hind basitarsus = 1; ≥ 0.40 × longer than hind basitarsus = 2
32* Tarsal claws Simple = 1; pectinate = 2
33* T1 ratio ≤ 1.70 × = 1; ≥ 2.0 × = 2
34 First laterotergite weakly curved posteriorly = 1 strongly curved posteriorly = 2
35 Spiracle of first laterotergite touching dorsal margin of first laterotergite = 1; located near median = 2
36 Spiracle of second laterotergite close to anterior margin, but not touching = 1; located near median = 2
37* Ovipositor sheath length longer than hind femur = 1; shorter than hind femur; unknown = ?
38 Ovipositor sheath shape ventro-apically round = 1; ventro-apically pointed = 2; unknown=?
39* Median longitudinal fold on hypopygium absent = 1; present = 2; unknown = ?

* Characters are based on or modified from Dangerfield et al. (1999)

Molecular data

Maximum likelihood analysis (ML) was conducted using MEGA11 (Tamura et al. 2021). For 16S, the analysis was conducted using the General Time Reversible (GTR) model (Nei and Kumar 2000). Bootstrapping was not conducted because only three species were included in the analysis. For 28S, the ML was performed using the Hasegawa-Kishino-Yano model (HKY) with 1,000 bootstrap replicates (Hasegawa et al. 1985). The substitution models were selected using ModelTest-NG (Darriba et al. 2020) on raxmlGUI 2.0 (Edler et al. 2021). All phylogenetic trees were rooted with Protomicroplitis calliptera as outgroup (GenBank Accesion Numbers: ON023818.1 (16S) and ON040756.1 (28S)) and edited via MEGA11 and Adobe Acrobat Pro DC (Adobe Systems, Inc).

Results and discussion

Generic relationships and character discussion (Fig. 1)

The Maximum Parsimony (MP) phylogenetic analysis based on morphological characters was conducted due to the issues with Heteropteron and Wesmaelella specimens mentioned above, and the limited molecular data obtained from only a few specimens of Neocardiochiles. In the MP consensus tree, Protomicroplitis was set as outgroup, and all the three ingroup genera are recovered as monophyletic groups. Based on the results, we resurrect Neocardiochiles to the generic level. A clade including Wesmaelella represented by Wesmaelella nigripennis (Szépligeti, 1902) was supported by eight synapomorphies (10-1; 13-2; 17-1; 20-1; 22-1; 33-1; 35-1; 36-1) and one homoplastic character (24-1) and recovered as the most plesiotypic member. 1r on fore wing (17-1) and RS2 (22-1) are easily observable characters to distinguish Wesmaelella from the members of Heteropteron and Neocardiochiles. A clade containing Heteropteron and Neocardiochiles were supported by six synapomorphies (1-2; 2-2; 21-2; 23-2; 25-2; 26-2) and five homoplastic characters (6-2 7-2 12-2 18-2 27-2). Three synapomorphies (13-1; 29-2; 30-2) and two homoplastic characters (19-2; 37-1) supported a clade with Heteropteron represented by the undescribed species. All the three unambiguous synapomorphies along with the ovipositor character (37-1; note: the undescribed species of Heteropteron possess a distinctively longer and more sinuate ovipositor than the members of Wesmaelella and Neocardiochiles) are easily visible diagnostic characters to identify Heteropteron. A clade including nine species of Neocardiochiles was supported by six synapomorphies (5-2; 8-2; 14-2; 15-2; 32-2; 34-2) and seven homoplastic characters (3-2; 9-2; 11-2; 16-2; 18-3; 28-2; 31-2) (Fig. 1). Among six unambiguous synapomorphies of Neocardiochiles, the presence of a median longitudinal furrow on the propodeum (14-2) and pectinate claws (32-2) are easily observable diagnostic characters to distinguish the Neocardiochiles members from members of Wesmaelella and Heteropteron. Regarding species relationships displayed by the phylogeny (Fig. 1), some Neocardiochiles species were not clearly delimited because we excluded characters only informative at the species-level due to the main purpose of the phylogeny (confirming the genus-level relationships). However, species of Neocardiochiles can be easily delimited by additional morphological characters and molecular data included below.

Molecular data

We did not attempt to obtain molecular data from Heteropteron and Wesmaelella specimens because they were collected in the early 1900s and/or were type specimens. Neocardiochiles specimens collected from late 1990s to early 2010s were used to obtain molecular data. Among nine species of Neocardiochiles, 16S sequences of two species, N. chriscarltoni sp. nov. and N. victoriae sp. nov., and 28S sequences of three species, N. alexeyi sp. nov., N. hasegawai comb. nov., and N. victoriae sp. nov., were obtained. Unfortunately, attempts to obtain DNA sequences from the other five species of Neocardiochiles failed. In the genetic distance analyses and maximum likelihood analyses, ~465 bp of 16S sequences and ~420 bp of 28S sequences were utilized as the final dataset, respectively. The length of 28S sequences used in the analysis was shorter than our target length because only the forward strand of N. hasegawai was successfully obtained. Interspecific genetic distance between N. chriscarltoni sp. nov. and N. victoriae sp. nov. was 12.1% for 16S (Table 3). For 28S sequences, the distances ranged from 1.3% to 1.5% (Table 4). As shown in the results, 28S interspecific genetic distances between species were much lower than 16S, indicating confirmation of species boundaries based on 28S sequences would be more difficult. 16S sequences exhibited high interspecific genetic distances but mitochondrial cytochrome c oxidase subunit I (COI) barcodes obtained using universally known markers (Folmer et al. 1994; Hebert et al. 2004) may be more useful to delimit Neocardiochiles species than 16S as confirmed in many other braconid studies (Smith et al. 2008; Smith et al. 2012; Fernandez-Triana et al. 2014; Kang et al. 2017; Fernandez-Triana et al. 2019; Meierotto et al. 2019; Fagan-Jeffries and Austin 2020; Sharkey et al. 2021a, b; Slater‐Baker et al. 2022). Two single gene trees (See Suppl. material 1: Maximum likelihood (ML) phylogeny based on 16S data and Suppl. material 2: Maximum likelihood (ML) phylogeny based on 28S data) were constructed, and the ML phylogeny based on 28S (See Suppl. material 2: Maximum likelihood (ML) phylogeny based on 28S data) was congruent with the morphology-based phylogeny (Fig. 1) in confirming a relatively early-diverging position for N. alexeyi despite the small number of sequenced taxa (Suppl. material 2).

Table 3.
Download as
CSV
XLSX

Estimates of genetic distances between 16S sequences.

N. chriscarltoni sp. nov. N. victoriae sp. nov. P. calliptera (outgroup)
N. chriscarltoni sp. nov. 0
N. victoriae sp. nov. 0.121
P. calliptera (outgroup) 0.101 0.116 0
Table 4.
Download as
CSV
XLSX

Estimates of genetic distances between 28S sequences.

N. alexeyi sp. nov. N. hasegawai N. victoriae sp. nov. P. calliptera (outgroup)
N. alexeyi sp. nov. 0
N. hasegawai 0.013
N. victoriae sp. nov. 0.015 0.013
P. calliptera (outgroup) 0.255 0.258 0.262 0

Taxonomy

Neocardiochiles Szépligeti, 1908

Heteropteron Brullé, 1846, synonymized by Dangerfield, Austin, and Whitfield (1999) and confirmed by Mercado and Wharton (2003), Papp (2014), Dabek et al. (2020). Type species: Heteropteron macula Brullé, 1846, designated by Viereck (1914)

Heteropteron whitfieldi Mercado, 2003 to Neocardiochiles whitfieldi (Mercado, 2003); Heteropteron kidonoi Dabek & Whitfield, 2020 to Neocardiochiles kidonoi (Dabek & Whitfield, 2020); Heteropteron hasegawai Dabek & Whitfield, 2020 to Neocardiochiles hasegawai (Dabek & Whitfield, 2020). New combinations.

Type species

Neocardiochiles fasciipennis Szépligeti, 1908.

Diagnosis

Neocardiochiles is most similar to the genera Heteropteron and Wesmaelella and shares the following characters: eyes without setae; median areola on propodeum absent; notauli weekly impressed and posteriorly absent; scutellar sulcus without any crenula. However, members of Neocardiochiles differ from Heteropteron and Wesmaelella by possessing pectinate claws; propodeum with median longitudinal furrow (Figs 2E, 3E, 4E, 6E, 7D, 8E), posterior submarginal carinae, and carinate lateral margin (Figs 2E, 3E, 4E, 6E, 7D, 8E); hypopygium with median longitudinal fold (Figs 3D, 4D, 6E, 8D).

Description

Body 6.5–11 mm. Head: Antenna 34–40-segmented. Face width 1.36–1.73 × longer than its height. Interantennal space with well-developed median carina. Width of anterior ocellus 0.96–1.15 × longer than POL. Eyes bulged and without interommatidial setae (Figs 2D, 3C, 4C, 6C, 7C, 8C); median width of eye about 0.90–1.32 × longer than the median width of gena in lateral view. Gena extended ventroposteriorly into sharp prominence. Clypeus 1.64–2.61 × longer than its height; clypeal tubercles absent. Mandible bidentate. Maxillary palpus six-segmented. Labial palpus four-segmented. Galea short. Glossa short. Occipital carina absent. Mesosoma: Notauli weakly impressed and absent posteriorly (Figs 2C, 3B, 4B, 6B, 7B, 8B). Scutellar sulcus weakly impressed except for Neocardiochiles alexeyi sp. nov., without crenula. Postscutellar depression absent. Pronotum entirely or mostly smooth with ventral longitudinal carina. Mesopleulon mostly smooth; posterior margin crenulate; precoxal sulcus absent (Fig. 5B). Metapleuron mostly smooth. Propodeum 0.39–0.50 × longer than its median width; mostly smooth; with median furrow; curved submarginal longitudinal carina on propodeum present posteriorly; lateral margin of propodeum carinate (Figs 2E, 3E, 4E, 6E, 7D, 8E). Legs: Basal spur on mid tibia 0.56–0.71 × longer than length of basitarsus. Hind tibia without apical cup-like projection; basal spur on hind tibia 0.48–0.62 × longer than length of basitarsus. Claws pectinate. Wings: Fore wing (RS+M)a vein present; second submarginal cell trapezoid; 1r absent; 3r absent; 3RSb evenly curved. Hind wing 2r-m absent; 2–1A absent. Metasoma: T1 1.06–2.22 × longer than its posterior width, anterior width 0.53–0.83 × longer than posterior width, entirely separated with lateral tergum by suture; Y-shaped suture present. T2 nearly rectangle, 0.30–0.49 × longer than its posterior width. Hypopygium with median fold (Figs 3D, 5D, 6E, 8D). Ovipositor sheath nearly straight to slightly downcurved, as long as hind tarsomeres 1–3 combined as long as mesosoma, evenly setose except for base.

Distribution

Neotropical region: Costa Rica, Ecuador, French Guiana, Mexico, and Suriname.

Biology

The two species for which hosts are known attack pyralid and depressariid caterpillars on Roupala (Proteaceae) (Dabek et al. 2020).

Diversity

Nine species (Szépligeti 1908; Mercado and Wharton (2003); Dabek et al. 2020; current work).

Key to species of Neocardiochiles of the New World

1 A. Hind femur entirely melanic 2
– B. Hind femur bicolored 4
– C. Hind femur entirely pale 6
2(1) A. Fore wing entirely infuscate N. whitfieldi
– B. Fore wing two-banded 3
3(2) A. T1 ~ 1.06 × longer than its posterior width N. chriscarltoni sp. nov.
– B. T1 ~ 1.63 × longer than its posterior width N. braeti sp. nov.
4(1) A. Mesoscutum entirely dark N. fasciipennis
– B. Mesoscutum entirely pale 5
5(4) A. Hind tibia mostly pale N. kidonoi
– B. Hind tibia mostly dark N. victoriae sp. nov.
6(1) A. Mesoscutum entirely pale N. hasegawai
– B. Mesoscutum entirely dark 7
7(6) A. T1 ~ 2.22 × longer than its posterior width, nearly rectangle N. alexeyi sp. nov.
– B. T1 ~ 1.09 × longer than its posterior width, trapezoid N. franki sp. nov.

Interactive key

To use the interactive key to species of Neocardiochiles in the New World (Suppl. material 3):

  1. Download the zipfile of the ALA version of DELTA Editor (Open DELTA 1.02 beta) (Dallwitz et al. 1999). Extract into the ‘C’ drive. The extracted folder name will be ‘open-delta-1.02-bin’. Java is required to operate DELTA Editor and Intkey.
  2. Download the folder (‘Neocardiochiles_DELTA_Key’), which includes all source files and images of the interactive key, using the following link (https://drive.google.com/drive/folders/1aLS3vzdK52uMV0702IopDWgXaSllpJQm?usp=sharing).
  3. Extract the zipfile of ‘Neocardiochiles_DELTA_Key’ into the ‘open-delta-1.02-bin’ folder.
  4. In the folder ‘Neocardiochiles_DELTA_Key’, open the file ‘Neocardiochiles_Intkey’.
  5. Users can then identify described species of Neocardiochiles using this interactive key.

Species descriptions

Neocardiochiles alexeyi Kang, sp. nov.

http://zoobank.org/A3A772FE-6C09-4B6A-8CF2-63C9A71E3AD4
Fig. 2A–E

Material examined

Holotype Ecuador • ♀; Yasuni Research Station, Yasuni National Park, Orellana province; 00°40.4'S, 76°23.861'W; 18–24.vii.2008; A. Tishechkin; AT 853MS-2; H16634. Will be deposited in CNC.

Diagnosis

Neocardiochiles alexeyi sp. nov. can be distinguished from other members of the Neocardiochiles by the combination of the following characters: antenna 34-segmented and with pale apex (Fig. 2A); glossa ~ 2.0 × longer than height of clypeus (Fig. 2D); scutellar sulcus moderately impressed (Fig. 2B); mesoscutum entirely dark; hind femur entirely pale; anterior width of median furrow of propodeum ~ 0.83 × longer than maximum width (Fig. 2E); T1 ~ 2.22 × longer than its posterior width; lateral sutures of T1 nearly parallel (Fig. 2E); T2 ~ 0.49 × longer than its posterior width (Fig. 2E); ovipositor sheath ~ 0.62 × longer than length of hind tibia (Fig. 2A).

Figure 2. 

Neocardiochiles alexeyi sp. nov. A lateral habitus B wings C dorsal habitus D dorsal anterior head E propodeum and T1–T2.

Molecular data

28S sequences (GenBank accession number: ON040823.1);

ATGAGGAGATTCACTGTTAGCATTACTAGTATTAATGCAAATTATGATATGATTATATGATCCTTGTGGTCACAATTATTATACTTATTTGTATTATTTTATTGGTTTTGTCAGCATGCACTTCTCCTCTAGTAGAACGTCGCGACCCGTTGAATGTTTATTTATGAGCCACATGGTAGTCTTATGTATTTTATACGCAAGACCAGTGAATTTCTAATAAACTATTTGACGGTATCTAAAATGGTATTGAGCCGCAAATTTTTTTTGCGTTAGATTTATTACAAGCTAGACTTACTTTAAGCAGTACGAATTTTATGTCGTCGTTTAAACTAGTCTGCTGTTAGTGATAATATCTTTAACTGGCTTAATTTTACCGGTCAGCGATGCTACTGCTTTGGGTACTTACAGGACCCGTCTTG.

Description

Body ~ 7.04 mm. Head: Antenna 34-segmented. Face width ~ 1.36 × wider than high (1.01:0.74). Width of anterior ocellus as long as POL (010:0.10). Eyes bulged and without interommatidial setae; median width of eye about ~ 1.23 × longer than the median width of gena in lateral view (0.37:0.30). Clypeus 2.20 × longer than its height (0.55:0.25). Galea 1.64 × longer than height of clypeus (0.41:0.25), relatively longer than other members of the genus. Glossa 1.96 × longer than height of clypeus (0.49:0.25). Occipital carina absent. Mesosoma: Notauli weakly impressed at anterior two thirds and absent posteriorly. Scutellar sulcus straight, moderately impressed, medially shallow, laterally relatively deep, without crenula. Pronotum mostly smooth, with ventral longitudinal carina. Metapleuron mostly smooth. Propodeum ~ 0.48 × longer than its median width (0.40:0.83); median longitudinal furrow present, nearly rectangle, anteriorly opened posteriorly closed by nucha, anterior width ~ 0.83 × longer than maximum width (0.05:0.06). Legs: Basal spur on mid tibia ~ 0.60 × longer than length of basitarsus (0.38:0.63). Basal spur on hind tibia ~ 0.54 × longer than length of basitarsus (0.60:1.11). Wings: Fore wing (RS+M)a present; second submarginal cell trapezoid, ~ 2.81 × longer than height (1.32:0.47); 1r absent; 3r absent; 3RSb evenly curved. Hind wing 2r-m absent; 2–1A absent. Metasoma: T1 ~ 2.22 × longer than its posterior width (0.91:0.41), anterior width ~ 0.83 × longer than posterior width (0.34:0.41), dorsally nearly rectangle; Y-shaped suture present. T2 nearly rectangle, ~ 0.49 × longer than its posterior width (0.35:0.71), with straight posterior margin. Hypopygium with median fold. Ovipositor sheath nearly straight, ~ 0.62 × longer than length of hind tibia (1.31:2.11), evenly setose except for base.

Color

Body mostly yellowish pale. The following areas dark: basal antenna (mostly), head, mandible, mesonotum, pronotum, mesopleuron, metapleuron, middle coxa, hind coxa, apical hind tibia, apical hind tarsi, apical metasoma. Fore wing with two bands; stigma mostly pale.

Etymology

Named in honor of Dr. Alexey K. Tishechkin, staff in the Plant Pest Diagnostics Branch, California Department of Food & Agriculture and a former member of the Louisiana State Arthropod Museum at LSU AgCenter, who collected the specimen in Ecuador.

Male

Unknown.

Host

Unknown.

Distribution

Neocardiochiles alexeyi sp. nov. is known from only one female specimen collected from Yasuni Biological Station, Orellana province, Ecuador.

Neocardiochiles braeti Kang, sp. nov.

http://zoobank.org/2B598860-7AC1-41A3-831E-5E6EB79F526E
Fig. 3A–E

Material examined

Holotype French Guiana • ♀; Roura, Montagne des chevaux; 22.xi.2008; S.E.A.G.; 2008–2009. Will be deposited in RBINS.

Diagnosis

Neocardiochiles braeti sp. nov. can be distinguished from other Neocardiochiles species by the combination of the following characters: antenna ≥ 37-segmented; scutellar sulcus weakly impressed (Fig. 3B); fore wing with two bands; hind femur entirely melanic; anterior width of median furrow of propodeum ~ 0.33 × longer than maximum width (Fig. 3E); T1 ~ 1.63 × longer than its posterior width; T2 ~ 0.42 × longer than its posterior width (Fig. 3E); ovipositor sheath as long as hind tibia (Figs 3A, 3B, 3D).

Figure 3. 

Neocardiochiles braeti sp. nov. A lateral habitus B dorsal habitus C fore wing D anterior head E lateral mesosoma F dorsal propodeum and T1.

Description

Body ~ 8.67 mm. Head: Antenna ≥ 37-segmented, apically broken. Face width ~ 1.46 × longer than its height (1.02:0.70) Width of anterior ocellus ~ 0.96 × longer than POL. Eyes bulged and without interommatidial setae; median width of eye about ~ 0.90 × longer than median width of gena in lateral view (0.44:0.49). Clypeus ~ 2.61 × longer than its height (0.60:0.23). Malar space 0.84 × longer than basal width of mandible. Mesosoma: Notauli anteriorly weakly impressed and absent posteriorly. Scutellar sulcus weakly impressed, medially shallow, laterally relatively deep, without crenula. Pronotum entirely smooth. Propodeum ~ 0.44 × longer than its median width (0.57:1.30); median longitudinal furrow present, elongate isosceles trapezoid, anteriorly opened posteriorly closed by nucha, anterior width ~ 0.33 × longer than maximum width (0.04:0.12). Legs: Basal spur on mid tibia ~ 0.64 × longer than length of basitarsus (0.47:0.74). Basal spur on hind tibia ~ 0.50 × longer than length of basitarsus (0.68:1.37). Wings: Fore wing (RS+M)a vein present; second submarginal cell trapezoid, ~ 3.01 × longer than height (1.66:0.55); 1r absent; 3r absent; 3RSb evenly curved; stigma about ~ 4.42 × longer than wide medially (2.08:0.47). Hind wing 2r-m absent; 2–1A absent. Metasoma: T1 ~ 1.63 × longer than its posterior width (1.19:0.73), anterior width ~ 0.63 × longer than posterior width (0.46:0.73), dorsally isosceles trapezoid; Y-shaped suture partially developed anteriorly, absent posteriorly. T2 nearly trapezoid, ~ 0.42 × longer than its posterior width (0.44:1.06), with curved posterior margin. Hypopygium with median fold. Ovipositor sheath slightly downcurved, ~ 1.03 × longer than length of hind tibia (2.92:2.81), evenly setose except for base.

Color

Head and mesosoma mostly black, metasoma mostly orange and black apically. Legs black or dark brown except for fore tarsus. Fore wing with two bands; stigma pale at apical two thirds.

Etymology

Named in honor of Mr Yves Braet who provided specimens collected in French Guiana for this study.

Male

Unknown.

Host

Unknown.

Distribution

Neocardiochiles braeti sp. nov. is known only from one female specimen collected from Roura, Montagne des chevaux, French Guiana.

Neocardiochiles chriscarltoni Kang, sp. nov.

http://zoobank.org/294D2CD0-0762-47EA-BB20-4115F21D9F0C
Figs 4A–E, 5A–B

Material examined

Holotype French Guiana • ♀; Roura, Montagne des chevaux; ix.2009; S.E.A.G.; 2008–2009, Piège Malaise. Will be deposited in RBINS.

Diagnosis

Neocardiochiles chriscarltoni sp. nov. is most similar to N. braeti sp. nov. However, N. chriscarltoni sp. nov. can be distinguished from other Neocardiochiles species by the combination of the following characters: antenna 38-segmented and with pale apex (Fig. 5A); scutellar sulcus weakly impressed (Fig. 4B); fore wing with two bands; hind femur entirely melanic; anterior width of median furrow of propodeum ~ 0.11 × longer than maximum width (Fig. 4E); T1 as long as its width (Fig. 4E); T2 ~ 0.30 × longer than its posterior width (Fig. 4E); ovipositor sheath ~ 0.48 × longer than length of hind tibia (Fig. 4A, D).

Figure 4. 

Neocardiochiles chriscarltoni sp. nov. A lateral habitus B dorsal habitus C anterior head D hypopygium and ovipositor sheath E dorsal propodeum and T1–T3.

Figure 5. 

Neocardiochiles chriscarltoni sp. nov. A antennae B mesopleuron.

Molecular data

16S sequences (GenBank accession number: ON059709.1);

CACCTGTTTATCAAAAACATGTCTTTTTGAAAATAATTTAAAGTCCAATCTGCTCAATGATTAATTAATTTAATAGCTGCAATATTTATAATTGTACTAAGGTAGCATAATCATTAGTTTATTAATTGTAAACTTGTATGAACGATTTGATGAAATAAATACTATTTCATTTTAAAAAAATAAATTTTTTTTTTAAGTTAAAAAACTTAAATAATATTAAAAGACGAGAAGACCCTTTAGAATTTTATAATAATAATTTATAAAAATTTTTATATATTTATAAATAATTATTATTTAATTGGGGTGATTATAAAATTTAATAAACTTTTATATAAATAAACAATAATTTTTGAATAAAATATATTTTTTTTAAAAAAATAAATTAAATTACCTAAGGGATAACAGCATAATTTTTTTAAAAAGCACAAATTTATAAAAAAGTTTATGACCTCGATGTTGAATTAAGA.

Description

Body ~ 7.43 mm. Head: Antenna 38-segmented. Face width ~ 1.47 × longer than its height (0.97:0.66). Width of anterior ocellus as long as POL (0.12:0.12). Eyes bulged and without interommatidial setae; median width of eye about ~ 1.32 × longer than the median width of gena in lateral view (0.50:0.38). Clypeus ~ 2.57 × longer than its height (0.59:0.23). Mesosoma: Notauli weakly impressed at anterior half and disappeared posteriorly. Scutellar sulcus weakly impressed, medially shallow, laterally relatively deep, without crenula. Pronotum mostly smooth, with ventral longitudinal carina. Propodeum ~ 0.39 × longer than its median width (0.53:1.36); median longitudinal furrow present, elongate isosceles trapezoid, anteriorly opened posteriorly closed by nucha, anterior width ~ 0.11 × longer than maximum width (0.02:0.18). Legs: Basal spur on mid tibia ~ 0.56 × longer than length of basitarsus (0.38:0.68). Basal spur on hind tibia ~ 0.48 × longer than length of basitarsus (0.52:1.08). Wings: Fore wing (RS+M)a vein present; second submarginal cell trapezoid; 1r absent; 3r absent; 3RSb evenly curved. Hind wing 2r-m absent; 2–1A absent. Metasoma: T1 ~ 1.06 × longer than its posterior width (0.82:0.77), anterior width ~ 0.66 × longer than posterior width (0.51:0.77), dorsally nearly rectangular; Y-shaped suture present. T2 nearly rectangle, ~ 0.30 × longer than its posterior width (0.38:1.28), with curved posterior margin. Hypopygium with median fold. Ovipositor sheath nearly straight and posteriorly enlarged, ~ 0.48 × longer than length of hind tibia (1.07:2.25), evenly setose except for base.

Color

Body mostly melanic; the following areas pale: four apical flagellomeres, basal maxillary and labial palpi, fore tarsi, metanotum (mostly), propodeum, anterior metasoma (mostly). Fore wing with two bands; stigma entirely melanic.

Etymology

Named in honor of Dr Christopher E. Carlton, the emeritus professor in the Department of Entomology at LSU AgCenter.

Male

Unknown.

Host

Unknown.

Distribution

Neocardiochiles chriscarltoni sp. nov. is known only from one female specimen collected from Roura, Montagne des chevaux, French Guiana.

Neocardiochiles fasciipennis Szépligeti, 1908, comb. nov.

Fig. 6A–E

Material examined

Lectotype Suriname • ♀; Michaelis.

Diagnosis

Morphological characters of Neocardiochiles fasciipennis are only known from holotype. The species is distinguished from other members of Neocardiochiles by the combination of the following characters: body ~ 11 mm; posterior margin of mesopleuron smooth; basal spur on hind tibia slightly shorter than the half length of hind basitarsus (Fig. 6A); forewing length ~ 13 mm; T1 ~ 1.35 × longer than apical width (Fig. 6E); ovipositor sheath as long as hind tarsomeres 1–3 combined.

Figure 6. 

Neocardiochiles fasciipennis A lateral habitus B dorsal habitus C anterior head D ventro-lateral hypopygium; arrow: median longitudinal fold E dorsal propodeum and T1–T3

Description

See Papp (2014).

Male

Unknown.

Host

Unknown.

Distribution

Suriname.

Neocardiochiles franki Kang, sp. nov.

http://zoobank.org/475828BF-D48F-4362-A4B9-9FEDE8842873
Figs 7A–E

Material examined

Holotype Costa Rica • ♀; 3 km SE of Rio Naranjo, Guanacaste; 1–5.vi.1992; F. D. Parker. Will be deposited in UWIM.

Diagnosis

Neocardiochiles franki sp. nov. is most similar to N. alexeyi sp. nov. However, N. franki sp. nov. can be distinguished from other Neocardiochiles species by the combination of the following characters: antenna ≥ 37-segmented; scutellar sulcus weakly impressed (Fig. 7B) mesoscutum entirely dark; hind femur entirely pale; anterior width of median furrow of propodeum ~ 0.18 × longer than maximum width (Fig. 7D); T1 trapezoid and as long as its width (Fig. 7B); T2, ~ 0.34 × longer than its posterior width (Fig. 7B); ovipositor sheath ~ 0.58 × longer than length of hind tibia (Fig. 7A).

Figure 7. 

Neocardiochiles franki sp. nov. A lateral habitus B dorsal habitus C fore wing D anterior head E dorsal propodeum and T1 F hypopygium, arrow: median longitudinal fold.

Description

Body ~ 9.36 mm. Head: Antenna ≥ 37-segmented, apically broken. Face width ~ 1.50 × longer than its height (1.11:0.74). Width of anterior ocellus ~ 1.11 × longer than POL (0.10:0.09). Eyes bulged and without interommatidial setae; median width of eye about ~ 1.32 × longer than median width of gena in lateral view (0.47:0.44). Clypeus ~ 2.41 × longer than its height (0.77:0.32). Mesosoma: Notauli weakly impressed at anterior half and absent posteriorly. Scutellar sulcus weakly impressed, medially shallow, laterally relatively deep, without crenula. Pronotum mostly smooth, with ventral longitudinal carina. Propodeum 0.50 × longer than its median width (0.61:1.22); median longitudinal furrow present, elongate isosceles trapezoid, anteriorly opened posteriorly closed by nucha, anterior width ~ 0.18 × longer than maximum width (0.03:0.17). Legs: Basal spur on mid tibia ~ 0.60 × longer than length of basitarsus (0.47:0.78). Basal spur on hind tibia ~ 0.62 × longer than length of basitarsus (0.83:1.33). Wings: Fore wing (RS+M)a vein present; second submarginal cell trapezoid, ~ 2.20 × longer than height (1.81:0.82); 1r absent; 3r absent; 3RSb evenly curved. Hind wing 2r-m absent; 2–1A absent. Metasoma: T1 ~ 1.09 × longer than its posterior width (1.20:1.10), anterior width ~ 0.53 × longer than posterior width (0.58:1.10), dorsally nearly trapezoid; Y-shaped suture present. T2 rectangle, ~ 0.34 × longer than its posterior width (0.54:1.58), with straight posterior margin. Hypopygium with median fold. Ovipositor sheath nearly straight and posteriorly enlarged, ~ 0.58 × longer than length of hind tibia (1.82:3.15), evenly setose except for base.

Color

Body mostly melanic; the following areas pale: maxillary and labial palpi, fore leg, middle femur; mid tibia; basal middle tarsus, hind femur, basal hind tibia, anterior metasoma (mostly). Fore wing with two bands; stigma mostly pale.

Etymology

Named in honor of Dr Frank Parker, the former head of the USDA Bee lab, who collected the specimen.

Male

Unknown.

Host

Unknown.

Distribution

Neocardiochiles franki sp. nov. is known only from one female specimen collected from 3 km SE of Rio Naranjo, Guanacaste, Costa Rica.

Neocardiochiles hasegawai (Dabek & Whitfield, 2020), comb. nov.

Material examined

Non-type specimen Costa Rica • ♀; Guanacaste, Area de Conservación Guanacaste, Sector Santa Rosa, Finca Jenny; 10.86333, -85.57443, 205 m; 14.xii.2010 (host caterpillar collection date); 01.i.2011 (host caterpillar pre-pupal date); 17.i.2011 (parasitoid eclosion date); Johan Vargas; DHJPAR0045389; host caterpillar (10-SRNP-15361; Stenoma cathosiota) on host plant (Roupala montana).

Diagnosis

Neocardiochiles hasegawai is most similar to N. alexeyi sp. nov. and N. franki sp. nov., but the members of N. hasegawai differ from other Neocardiochiles species by possession of the two following characters: mesoscutum entirely pale; hind femur entirely pale.

Molecular data

28S sequences (GenBank accession number: ON040755.1);

ATGAGGAGATTCACTGTTAGCATTACTAGTATTAATGCAAATTATGATATGATTATATATGATTCTTGTGGTCACAATTATTATACTTATTTGTATTATTTTATTGGTTTTGTCAGCATGCACTTCTCCTCTAGTAGAACGTCGCGACCCGTTGAATGTTTATTTATGAGTCACATGGTAGTCTTATGTATTTTATACGCAAGACCAGTGAATTTCTAATAAACTGTTTGACGGTATCTAAAATGGTATTGAGCCGCAAATTTTTTTTTGCGTTAGATTTATCACAAGCTAGGCTTACTTTAAGCAGTACGAATTTTATGTCGTCGTTTAAACTAGTCTGCTGTTAGTGATAATATCTTTAACTGGCTTAATTACCGGTCAGCGATGCTACTGCTTTGGGTACTTACAGGACCCGTCTTG.

Description

See Dabek et al. (2020).

Male

Body length slightly longer than female (Dabek et al. 2020).

Host

Reared from caterpillars of Carthara abrupta (Pyralidae) on Roupala montana (Proteaceae) (Dabek et al. 2020).

Distribution

Costa Rica (ACG).

Neocardiochiles kidonoi (Dabek & Whitfield, 2020), comb. nov.

Material examined

Non-type specimen Costa Rica • ♀; Guanacaste, Area de Conservación Guanacaste, Sector El Hacha, Quebrada Pitahaya; 11.01182, -85.53168; 320 m; 11.ix.2013 (host caterpillar collection date); 14.ix.2013 (host caterpillar pre-pupal date); 02.x.2013 (parasitoid eclosion date); Roster Moraga; DHJPAR0053597; host caterpillar (13-SRNP-22162; Stenoma cathosiota) on host plant (Roupala montana).

Diagnosis

Neocardiochiles kidonoi is most similar to N. victoriae sp. nov., but members of N. kidodoi can be distinguished from other Neocardiochiles members by possession of the following characters: mesoscutum entirely pale; hind femur bicolored; hind tibia mostly pale.

Description

See Dabek et al. (2020).

Male

Body length slightly shorter than female (Dabek et al. 2020).

Host

Reared from larvae of Stenoma cathosiota (Depressariidae) on Roupala montana (Proteaceae) (Dabek et al. 2020).

Distribution

Costa Rica (ACG).

Neocardiochiles victoriae Kang, sp. nov.

http://zoobank.org/432A06CB-A4CC-4773-864E-703BB836B023
Fig. 8A–E

Material examined

Holotype French Guiana • ♀; Degrad Laurens, Crique Sapokaï; 95 m; 24.x.–30.x1998; leg. A.E.I. guyane; P Malaise. Will be deposited in RBINS.

Diagnosis

Neocardiochiles victoriae sp. nov. is most similar to N. kidonoi, but the only knonw female member of N. victoriae differs from other members of Neocardiochiles by the following characters: antenna 40-segmented with entirely reddish flagellomeres (Fig. 8A); scutellar sulcus weakly impressed; mesoscutum entirely pale; hind femur bicolored; hind tibia mostly melanic; anterior width of median furrow of propodeum ~ 0.19 × longer than maximum width (Fig. 8E); T1 ~ 1.39 × longer than its posterior width (Fig. 8E); T2 ~ 0.39 × longer than its posterior width (Fig. 8E); ovipositor sheath as long as hind tibia (Fig. 8A).

Figure 8. 

Neocardiochiles victoriae sp. nov. A lateral habitus B dorsal habitus C anterior head D hypopygium E dorsal propodeum and T1–T3.

Molecular data

28S sequences (GenBank accession number: ON040754.1);

ATGAGGAGATTCACTGTTAGCATTACTAATATTAATGCAAATTATGATATCATTATATGATCCTTGTGGTCACAATTATTATACTTATTTGTATTATTTTATTGGTTTTGTCAGCATGCACTTCTCCTCTAGTAGAACGTCGCGACCCGTTAAATGTTTATTTATGAGTCACATGGTAGTCTTATGTATTTTATACGCAAGACCAGTGAATTTCTAATAAACTGTTTGACGGTATCTAAAATGGTATTGAGCCGCAAATTTTTTTTGCGTTAGATTTATTACAAGCTAGGCTTACTTTAAGCAGTACGAATTTTATGTCGTCGTTTAAACTAGTCTGCTGTTAGTGATAATATCTTTAACTGGCTTAATTACCGGTCAGCGATGCTACTGCTTTGGGTACTTACAGGACCCGTCTTG.

16S sequences (GenBank accession number: ON059710.1);

TCCCCTGTTTATCAAAAACATGTCTTATTGAAAATAATTTTAAGTCAAATCTGCTCAATGATAATTTTATTAAATAGCTGCAGTAAATATGACTGTACTAAGGTAGCATAATAAATAGTTTATTAATTATAAACTTGTATGAAAGATTTAATGTAATAAATACTGTTTCAATTTAAAAAAATAAATTTTTTTTTTAAGTAAAAAAACTTAAATAAAATTAAAAGACGAGAAGACCCTATAGAATTTTATAAATTAATTTTAATTAATTTATTTTTAATTAAAATTAAATTATTTAATTGGGGAGATTATAAAATTTAAAAAACTTTTATATAAATTTACAATAATTATTGAATAAAATATAATTTTTAAAAAAAATAAAATAAATTACCTTAGGGATAACAGCATAATTTTTTTTTTAAGTTCGTATTACTAAAAAAGATTATGACCTCGATGTTGAATTAAGA

Description

Body ~ 9.35 mm. Head: Antenna 40-segmented. Face width ~ 1.73 × longer than its height (1.28:0.74). Width of anterior ocellus ~ 1.15 × longer than POL (0.15:0.13). Eyes bulged and without interommatidial setae; median width of eye about ~ 1.04 × longer than median width of gena in lateral view (0.58:0.56). Clypeus ~ 2.39 × longer than its height (0.74:0.31). Mesosoma: Notauli weakly impressed at anterior half and absent posteriorly. Scutellar sulcus weakly impressed, medially shallow, laterally relatively deep, without crenula. Pronotum mostly smooth, with ventral longitudinal carina. Metapleuron mostly smooth. Propodeum ~ 0.39 × longer than its median width (0.66:1.68); median longitudinal furrow present, elongate isosceles trapezoid, anteriorly opened posteriorly closed by nucha, anterior width ~ 0.19 × longer than maximum width (0.03:0.16). Legs: Basal spur on mid tibia ~ 0.71 × longer than length of basitarsus (0.62:0.87). Basal spur on hind tibia 0.50 × longer than length of basitarsus (0.84:1.68); claw pectinate. Wings: Fore wing (RS+M)a vein present; second submarginal cell trapezoid; 1r absent; 3r absent; 3RSb evenly curved. Hind wing 2r-m absent; 2–1A absent. Metasoma: T1 ~ 1.39 × longer than its posterior width (1.42:1.02), anterior width ~ 0.56 × longer than posterior width (0.57:1.02), dorsally isosceles trapezoid; Y-shaped suture present. T2 nearly oval, ~ 0.39 × longer than its posterior width (0.49:1.27), with curved posterior margin. Hypopygium with median fold. Ovipositor sheath slightly downcurved, ~ 1.04 × longer than length of hind tibia (3.38:3.25), evenly setose except for base.

Color

Body mostly orange. The following areas dark: antenna (reddish brown), head, ventral fore notum, fore coxa, fore trochanter and trochantellus (mostly), fore femur (mostly); middle coxa, middle trochanter and trochantellus (mostly), middle femur (mostly), mid tibia (apically); hind femur (apically); hind tibia (except for inner tibia), fifth to last terga (dorsally), ovipositor sheath. Fore wing with two bands; stigma mostly pale.

Etymology

Named in honor of Ms Victoria Bayless, a curator in the Louisiana State Arthropod Museum at LSU AgCenter and a former president of the Coleopterists Society, who is the best friend in LSU and has red hair as the specimen has reddish antennae.

Male

Unknown.

Host

Unknown.

Distribution

Neocardiochiles victoriae sp. nov. is known only from one female specimen collected from Degrad Laurens, Crique Sapokaï, French Guiana.

Neocardiochiles whitfieldi (Mercado, 2003), comb. nov.

Material examined

Holotype Mexico • ♂; 16 km north of Autlan, Jalisco; 7.vii.1984; Carrol, Schaffner, Friedlander. Deposited in TAMU.

Diagnosis

The known male of Neocardiochiles whitfieldi can be easily distinguished from other members of Neocardiochiles by the following color characters: head and mesosoma darker; wings entirely melanic; metasoma orange.

Description

(Male). See Mercado and Wharton (2003).

Female

Unknown.

Host

Unknown.

Distribution

Mexico.

Acknowledgements

We thank Drs Daniel Janzen and Winnie Hallwachs at the University of Pennsylvania, Dr Michael Sharkey at HIC, Dr Scott Shaw at UWIM, Dr Karen Wright at TAMU, Dr Tommy McElrath at INHS, Dr Zoltan Vas at HNHM, and Mr Yves Braet in Belgium for loan of specimens and museum research. We also thank Société Entomologique Antilles-Guyane (S.E.A.G) and Association Entomologique des Inselbergs de Guyane (A.E.I. Guyane) for their massive collecting and sorting efforts in French Guiana. In addition, we are grateful to Drs Chris Carlton, Michael Stout, Claudia Husseneder, and Rodrigo Diaz in the Department of Entomology at LSU AgCenter for invaluable advice and supports. Also, the first and second authors would like to acknowledge Ms Victoria Bayless, curator in Louisiana State Arthropod Museum for her encouragement and friendship. In addition, we are grateful to Dr Scott Herke at the LSU Genomics Facility for his help and work. Finally, we thank the LSU Agricultural Center and LSU Entomology Department for financial and equipment support.

References

  • Belshaw R, Lopez-Vaamonde C, Degerli N, Quicke DL (2001) Paraphyletic taxa and taxonomic chaining: evaluating the classification of braconine wasps (Hymenoptera:Braconidae) using 28S D2–3 rDNA sequences and morphological characters. Biological Journal of the Linnean Society 73: 411–424. https://doi.org/10.1111/j.1095-8312.2001.tb01370.x
  • Campbell B, Heraty J, Rasplus JY, Chan K, Steffen-Campbell J, Babcock C (2000) Molecular systematics of the Chalcidoidea using 28S-D2 rDNA. Hymenoptera evolution, biodiversity and biological control. CSIRO Publishing, Collingwood, Australia 26: 59–73.
  • Chen YI, Pike KS, Greenstone MH, Shufran KA (2006) Molecular markers for identification of the hyperparasitoids Dendrocerus carpenteri and Alloxysta xanthopsis in Lysiphlebus testaceipes parasitizing cereal aphids. Biocontrol 51(2): 183–194. https://doi.org/10.1007/s10526-005-1518-0
  • Dabek EZ, Whitfield JB, Hallwachs W, Janzen DH (2020) Two new reared species of Heteropteron Brullé (Hymenoptera, Braconidae, Cardiochilinae) from northwest Costa Rica, with the first definitive host records for the genus. Journal of Hymenoptera Research 77: 151–165. https://doi.org/10.3897/jhr.77.50577
  • Dallwitz MJ, Paine TA, Zurcher EJ (1999) User’s guide to the DELTA Editor. http://delta-intkey.com [accessed on Mar. 12. 2022]
  • Dallwitz MJ, Paine TA, Zurcher EJ (2000) Principles of interactive keys. http://delta-intkey.com [accessed on Mar. 12. 2022]
  • Dangerfield PC, Austin AD, Whitfield JB (1999) Systematics of the world genera of Cardiochilinae (Hymenoptera: Braconidae). Invertebrate Systematics 13(6): 917–976. https://doi.org/10.1071/IT98020
  • Darriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T (2020) ModelTest-NG: a new and scalable tool for the selection of DNA and protein evolutionary models. Molecular Biology and Evolution 37(1): 291–294. https://doi.org/10.1093/molbev/msz189
  • Dowton M, Austin AD (1994) Molecular phylogeny of the insect order Hymenoptera: apocritan relationships. Proceedings of the National Academy of Sciences of the United States of America 91(21): 9911–9915. https://doi.org/10.1073/pnas.91.21.9911
  • Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5): 1792–1797. https://doi.org/10.1093/nar/gkh340
  • Edler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: a graphical interface and toolkit for phylogenetic analyses using RAxML. Methods in Ecology and Evolution 12(2): 373–377. https://doi.org/10.1111/2041-210X.13512
  • Fagan-Jeffries EP, Austin AD (2020) Synopsis of the parasitoid wasp genus Cotesia Cameron, 1891 (Hymenoptera: Braconidae: Microgastrinae) in Australia, with the description of seven new species. European Journal of Taxonomy 667: 1–70. https://doi.org/10.5852/ejt.2020.667
  • Fernandez-Triana J, Whitfield J, Rodriguez J, Smith M, Janzen D, Hajibabaei M, Burns J, Solis A, Brown J, Cardinal S, Goulet H, Hebert P (2014) Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae) from Area de Conservación Guanacaste, northwestern Costa Rica, with keys to all described species from Mesoamerica. ZooKeys 383: 1–565. https://doi.org/10.3897/zookeys.383.6418
  • Fernandez-Triana J, Boudreault C, Dapkey T, Smith MA, Hallwachs W, Janzen D (2019) A revision of Dolichogenidea (Hymenoptera, Braconidae, Microgastrinae) with the second mediotergite broadly rectangular from Area de Conservación Guanacaste, Costa Rica. ZooKeys 835: 87–123. https://doi.org/10.3897/zookeys.835.33440
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Hasegawa M, Kishino H, Yano T (1985) Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22(2): 160–174. https://doi.org/10.1007/BF02101694
  • Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America 101(41): 14812–14817. https://doi.org/10.1073/pnas.0406166101
  • Kang I, Chapman EG, Janzen DH, Hallwachs W, Dapkey T, Smith MA, Sharkey MJ (2017) Revision of the species of Lytopylus from Area de Conservación Guanacaste, northwestern Costa Rica (Hymenoptera, Braconidae, Agathidinae). ZooKeys 721: 93–158. https://doi.org/10.3897/zookeys.721.20287
  • Maddison WP, Maddison DR (2021) Mesquite: a modular system for evolutionary analysis. Version 3.70. http://www.mesquiteproject.org [accessed on Oct. 10. 2021]
  • Madeira F, mi Park Y, Lee J, Buso N, Gur T, Madhusoodanan N, Basutkar P, Tivey ARN, Potter SC, Finn RD, Lopez R (2019) The EMBL-EBI Search and Sequence Analysis Tools APIs in 2019. Nucleic Acids Research 47: W636–W641. https://doi.org/10.1093/nar/gkz268
  • Meierotto S, Sharkey MJ, Janzen DH, Hallwachs W, Hebert PDN, Chapman EG, Smith MA (2019) A revolutionary protocol to describe understudied hyperdiverse taxa and overcome the taxonomic impediment. Deutsche Entomologische Zeitschrift 66(2): 119–145. https://doi.org/10.3897/dez.66.34683
  • Mercado I, Wharton RA (2003) Mexican cardiochiline genera (Hymenoptera: Braconidae), including a preliminary assessment of species-groups in Toxoneuron Say and Retusigaster Dangerfield, Austin and Whitfield. Journal of Natural History 37(7): 845–902. https://doi.org/10.1080/00222930110097167
  • Murphy N, Banks JC, Whitfield JB, Austin AD (2008) Phylogeny of the microgastroid complex of subfamilies of braconid parasitoid wasps (Hymenoptera) based on sequence data from seven genes, with an improved estimate of the time of origin of the lineage. Molecular Phylogenetics and Evolution 47: 378–395. https://doi.org/10.1016/j.ympev.2008.01.022
  • Nei M, Kumar S (2000) Molecular Evolution and Phylogenetics. Oxford University Press, Oxford, 352 pp.
  • Papp J (2014) A revisional study on Szépligeti’s cardiochiline type specimens deposited in the Hungarian Natural History Museum, Budapest (Hymenoptera, Braconidae: Cardiochilinae). In Annales historico-naturales Musei nationalis hungarici 106: 169–214.
  • Sharkey MJ, Wharton RA (1997) Morphology and terminology. In: Wharton RA, Marsh PM, Sharkey MJ (Eds) Manual of the New World genera of the family Braconidae (Hymenoptera). Special Publication of the International Society of Hymenopterists, No 1, Washington DC, 19–37.
  • Sharkey MJ, Janzen DH, Hallwachs W, Chapman EG, Smith MA, Dapkey T, Brown A, Ratnasingham S, Naik S, Manjunath R, Perez K, Milton M, Hebert P, Shaw SR, Kittel RN, Solis MA, Metz MA, Goldstein PZ, Brown JW, Quicke DLJ, van Achterberg C, Brown BV, Burns JM (2021a) Minimalist revision and description of 403 new species in 11 subfamilies of Costa Rican braconid parasitoid wasps, including host records for 219 species. ZooKeys 1013: 1–665. https://doi.org/10.3897/zookeys.1013.55600
  • Sharkey MJ, Baker A, McCluskey K, Smith A, Naik S, Ratnasingham S, Manjunath R, Perez K, Sones J, D’Souza M, Jacques BS, Hebert P, Hallwachs W, Janzen D (2021b) Addendum to a minimalist revision of Costa Rican Braconidae: 28 new species and 23 host records. ZooKeys 1075: 77–136. https://doi.org/10.3897/zookeys.1075.72197
  • Slater‐Baker MR, Austin AD, Whitfield JB, Fagan‐Jeffries EP (2022) First record of miracine parasitoid wasps (Hymenoptera: Braconidae) from Australia: molecular phylogenetics and morphology reveal multiple new species. Austral Entomology 61(1): 49–67. https://doi.org/10.1111/aen.12582
  • Smith MA, Rodriguez JJ, Whitfield JB, Deans AR, Janzen DH, Hallwachs W, Hebert PD (2008) Extreme diversity of tropical parasitoid wasps exposed by iterative integration of natural history, DNA barcoding, morphology, and collections. Proceedings of the National Academy of Sciences 105(34): 12359–12364. https://doi.org/10.1073/pnas.0805319105
  • Smith MA, Fernández-Triana JL, Eveleigh E, Gómez J, Guclu C, Hallwachs W, Hebert PDN, Hrcek J, Huber JT, Janzen DH, Mason PG, Miller S, Quicke DLJ, Rodriguez JJ, Rougerie R, Shaw MR, Várkonyi G, Ward D, Whitfield JB, Zaldivar-Riveron A (2012) DNA barcoding and the taxonomy of Microgastrinae wasps (Hymenoptera, Braconidae): impacts after 8 years and nearly 20,000 sequences. Molecular Ecology Resources 13(2): 168–176. https://doi.org/10.1111/1755-0998.12038
  • Szépligeti V (1908) Braconiden aus der Sammlung des Ungarischen National-Museums. II Teil. Annales Historico-Naturales Musei Nationalis Hungarici 6: 397–427.
  • Whitfield JB, Dangerfield PC (1997) Subfamily Cardiochilinae. In: Wharton RA, Marsh PM, Sharkey MJ (Eds) Manual of the New World Genera of the Family Braconidae (Hymenoptera). International Society of Hymenopterists, Washington DC, 177–183.
  • Yu DS, van Achterberg CV, Horstmann K (2016) Taxapad 2016, Ichneumonoidea 2015. Database on flash-drive. Ottawa, Ontario.

Supplementary materials

Supplementary material 1 

Maximum likelihood (ML) phylogeny based on 16S data Maximum likelihood (ML) phylogeny based on 16S data indicating the relationships of Neocardiochiles chriscarltoni sp. nov. and N. victoriae sp. nov. Protomicroplitis calliptera (Hymenoptera: Braconidae: Microgastrinae) is included as the outgroup.

Ilgoo Kang, James Whitfield, Brittany Owens, Junyan Chen

Data type: Image

Explanation note: Maximum likelihood (ML) phylogeny based on 16S data indicating the relationships of Neocardiochiles chriscarltoni sp. nov. and N. vitoriae sp. nov. Protomicroplitis calliptera (Hymenoptera: Braconidae: Microgastrinae) is included as the outgroup.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (36.20 kb)
Supplementary material 2 

Maximum likelihood (ML) phylogeny based on 28S data Maximum likelihood (ML) phylogeny based on 28S data indicating the relationships of Neocardiochiles chriscarltoni sp. nov. and N. victoriae sp. nov. Protomicroplitis calliptera (Hymenoptera: Braconidae: Microgastrinae) is included as the outgroup.

Ilgoo Kang, James Whitfield, Brittany Owens, Junyan Chen

Data type: Image

Explanation note: Maximum likelihood (ML) phylogeny based on 28S data indicating the relationships of Neocardiochiles chriscarltoni sp. nov. and N. vitoriae sp. nov. Protomicroplitis calliptera (Hymenoptera: Braconidae: Microgastrinae) is included as the outgroup.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (57.30 kb)
Supplementary material 3 

Neocardiochiles_DELTA_Key

Ilgoo Kang, James Whitfield, Brittany Owens, Junyan Chen

Data type: Delta interactive key

Explanation note: Files and sources of DELTA Interactive Key.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (10.73 MB)
Supplementary material 4 

Character matrix for Heteropteron, Wesmaelella, and Neocardiochiles (Hymenoptera: Braconidae: Cardiochilinae)

Ilgoo Kang, James Whitfield, Brittany Owens, Junyan Chen

Data type: Nexus File

Explanation note: Character matrix for Heteropteron, Wesmaelella, and Neocardiochiles (Hymenoptera: Braconidae: Cardiochilinae) used in phylogenetic analysis.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (6.83 kb)
login to comment