Research Article
Print
Research Article
Encarsia hera Lahey & Andreason (Hymenoptera, Aphelinidae): a charismatic new parasitoid of Aleurocybotus Quaintance & Baker (Hemiptera, Aleyrodidae) from Florida
expand article infoZachary Lahey‡, Alvin M. Simmons‡, Sharon A. Andreason‡
‡ United States Department of Agriculture, Agricultural Research Service, U.S. Vegetable Laboratory, Charleston, United States of America

Corresponding author: Zachary Lahey ( zachary.lahey@usda.gov )

Corresponding author: Sharon A. Andreason ( sharon.andreason@usda.gov )

Academic editor: Petr Janšta
© 2022 Zachary Lahey, Alvin M. Simmons, Sharon A. Andreason.
This is an open access article distributed under the terms of the CC0 Public Domain Dedication.
Citation: Lahey Z, Simmons AM, Andreason SA (2022) Encarsia hera Lahey & Andreason (Hymenoptera, Aphelinidae): a charismatic new parasitoid of Aleurocybotus Quaintance & Baker (Hemiptera, Aleyrodidae) from Florida. Journal of Hymenoptera Research 94: 89-104. https://doi.org/10.3897/jhr.94.94677
ZooBank: urn:lsid:zoobank.org:pub:18EA5CA5-AA6D-4D47-8046-D5CF392B5840
Open Access

Abstract

A new, biparental species of the genus Encarsia Förster (Hymenoptera: Aphelinidae), E. hera Lahey & Andreason, sp. nov., is characterized based on morphological and molecular data. The parasitoid was reared from the puparia of its host, an undescribed species of the grass-feeding aleyrodine genus Aleurocybotus Quaintance & Baker (Hemiptera: Aleyrodidae) collected in Gainesville, Florida. The same whitefly is newly recorded from Charleston, South Carolina, where it is a pest of ornamental Muhly grass [Muhlenbergia capillaris (Lam.) Trin. (Poaceae)]. A phylogenetic analysis based on a fragment of 28S ribosomal DNA in 34 Encarsia species placed E. hera, sp. nov., within the E. luteola-group, a result concordant with its morphology. A key to the Encarsia species reared from Aleurocybotus is provided.

Keywords

DNA, new species, phylogenetics, whitefly

Introduction

Florida is home to the largest number of whitefly (Hemiptera: Aleyrodidae) species in the United States (Hodges and Evans 2005; L. Deeter, pers. comm.). While many of these species have been described, the discovery of new aleyrodid species is not uncommon, nor is the establishment of extralimital, adventive whiteflies [e.g., Aleurodicus rugioperculatus Martin; Asiothrixus antidesmae (Takahashi); Singhiella simplex (Singh)] (Stocks 2013). It has been known for several years that an undescribed species of the genus Aleurocybotus Quaintance & Baker exists in Florida (G. Evans, pers. comm.). The undescribed species can be separated from its congeners by a combination of morphological characters found in the immature and adult stage (G. Evans and N. von Ellenrieder, pers. comm.).

Species of Aleurocybotus are unusual among whiteflies in that they feed exclusively on grasses (Poaceae) and sedges (Cyperaceae) (Russell 2000). Among four known species, A. cereus Martin was described from Belize (Martin 2005). The remaining three described species are recorded from the west and east coasts of the United States (Quaintance 1899; Russell 1964; von Ellenrieder and Bailey 2022), and two of these, A. graminicolus (Quaintance) and A. occiduus Russell, have been collected in Florida.

Natural enemies associated with Aleurocybotus include several species of chalcidoid parasitoid Hymenoptera in four genera: Encarsia Förster and Eretmocerus Haldeman (Aphelinidae) (Myartseva et al. 2009); Metaphycus Mercet (Encyrtidae) (Myartseva and Cancino 2010); and Euderomphale Girault (Eulophidae) (LaSalle and Schauff 1994). The latter three genera are infrequently collected from Aleurocybotus; for discussions of those species, the reader is referred to the above references.

The genus Encarsia contains approximately 450 described species (Kresslein et al. 2020), although conservative estimates of the number of species is 10× that number (Polaszek et al. 2009). The primary hosts of Encarsia are whiteflies, although other groups of sternorrhynchous Hemiptera and insect eggs may also be attacked (Polaszek 1991; Evans et al. 1995; Heraty et al. 2008; Polaszek and Luft Albarracin 2011). Several species have been at the center of successful biological control programs, which makes this genus of considerable economic importance (Clausen and Berry 1932; Hart et al. 1978; Sailer et al. 1984; Hoddle et al. 1998). The purpose of this study is to describe a new species of Encarsia reared from a pestiferous, undescribed species of Aleurocybotus from the southeastern United States, place the Encarsia species within the context of the genus based on a phylogenetic analysis of 28S ribosomal DNA, and provide a key to the species of Encarsia known to attack Aleurocybotus.

Materials and methods

Specimen collection

Immature and adult Aleurocybotus were collected in 2022 from infested ornamental Muhly grass [Muhlenbergia capillaris (Lam.) Trin. (Poales: Poaceae)] in Gainesville, Florida (Alachua County) and Charleston, South Carolina (Charleston County), USA. Representative series of unparasitized puparia and other whitefly life stages were collected into 95% ethanol and slide-mounted following the protocol of Martin (2004), except that clearing of specimens took place in an ATL lysis buffer-Proteinase K solution, the first step in a non-destructive DNA extraction protocol that retains the cuticle of the insect for subsequent morphological examination. Parasitoid specimens were reared directly from their host. Parasitized whitefly puparia were excised from portions of leaf tissue using a cork borer (5 mm diameter), placed in size 0 gelatin capsules (Pure Planet Products, Scottsdale, Arizona), and monitored daily for emergence. Reared parasitoid specimens were killed directly in 95% ethanol and stored at -20 °C until DNA extraction.

DNA Extraction & PCR

Genomic DNA was extracted from Aleurocybotus puparia, adults, and single wasps using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). Individual specimens were first removed from ethanol and allowed to air dry on a Kimwipe for approximately 30 s. The specimen was then transferred to an Eppendorf tube containing 90 µl ATL lysis buffer to which 20 µl proteinase K was added. Tissue digestion was achieved by incubating the reaction mixture for 8 hrs at 56 °C. Tubes were agitated periodically, by hand, to ensure the specimen remained in the reaction mixture at the bottom of the tube. Most specimens were satisfactorily cleared after 8 hrs in the reaction mixture, but some were left for 24 hrs without damaging the specimen. Following tissue digestion, specimens were removed from the reaction mixture directly into distilled water where they remained until slide-mounting. Extracted parasitoids were placed on microscope slides following the protocol of Polaszek et al. (2013). The extract was then processed per the manufacturer’s instructions except that the AE buffer used in the final elution step was warmed to 55 °C, and the final elution volume per sample was 50 µl. DNA extracts were then stored at -20 °C until use in PCR.

The standard 5' barcode region of the cytochrome c oxidase subunit I (COI) gene (Folmer et al. 1994) and the 28S D2 and D3 domains of the 28S large ribosomal subunit (28S-D2-3) were targeted for amplification by PCR. The standard barcode primers (HCO2198/LCO1490) do not adequately amplify this region from many chalcidoids. Therefore, we utilized the two primer sets from Fusu and Polaszek (2017) that produce overlapping ‘mini-barcode’ sequences that can be assembled into a full consensus barcode. Primer sequences for each genomic region are listed in Table 1. The thermocycling conditions for the 28S-D2-3 region followed Andreason et al. (2019) and that of COI followed Fusu and Polaszek (2017) and Polaszek et al. (2022). PCR amplicons were visualized on a 1.5% agarose gel in 1X TAE buffer stained with SYBR Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, USA) and a TrackIT 1 Kb Plus DNA Ladder (Invitrogen, Waltham, MA, USA) to estimate product sizes. Both strands of each amplicon were sequenced on an ABI 3730xl DNA Analyzer by Eton Bioscience, Inc. (Research Triangle Park, NC, USA). Forward and reverse sequences of each amplicon were assembled with the Geneious assembler at the Highest Sensitivity/Slow setting in Geneious Prime (version 2022.0.2). Newly generated sequences for all Encarsia species used in the phylogenetic analyses have been deposited in GenBank (Table 2).

Table 1.
Download as
CSV
XLSX

PCR primer sets used in this study.

Primer Orientation Region Sequence (5'–3') Reference
MChaF1 Forward COI A CCTCGAATAAATAATATAAGATT Fusu and Polaszek 2017
HCO2198 Reverse TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994
LCO1490M Forward COI B CAACAAATCATAAAGATATTGG Fusu and Polaszek 2017; Folmer et al. 1994
MChaR1 Reverse CCYGTTCCAAYAAATATTCT Fusu and Polaszek 2017
D23F Forward 28S-D2-3 GAGAGTTCAAGAGTACGTG Park and O’Foighil 2000
D3B Reverse TCGGAAGGAACCAGCTACTA Nunn et al. 1996; Whiting et al. 1997
Table 2.
Download as
CSV
XLSX

CUIDs, host records, GenBank accession numbers, and sequence lengths associated with the Encarsia specimens newly sequenced for this study.

Taxon CUID Host GenBank Accession Sequence Length (bp)
Encarsia citrella OSUC 835434 Aleuroplatus sp. > OP133209 (28S) 901
Encarsia protransvena OSUC 835443 Parabemisia myricae > OP133210 (28S) 742
Encarsia sp. OSUC 835445 Tetraleurodes sp. > OP133211 (28S) 746
OSUC 835446 > OP133212 (28S) 745
Encarsia lahorensis OSUC 835456 Dialeurodes citri > OP133213 (28S) 1,085
Encarsia sp.a OSUC 863826 Unknown > OP133214 (28S) 713
Encarsia hera OSUC 863846 Aleurocybotus sp. > OP146609 (28S) 494
> OP270223 (COI) 673
OSUC 863847 > OP133215 (28S) 750
> OP270224 (COI) 674

a Specimen was collected with a sweep net.

Phylogenetic analyses

Phylogenetic analyses were conducted following Polaszek et al. (2021). Maximum likelihood phylogenies were estimated for the 28S-D2-3 region of 34 Encarsia species using IQ-TREE (v. 2.1.3) (Minh et al. 2020). This gene region in Encarsia is fast-evolving and accumulates mutations at a rate that provides sufficient phylogenetic signal to delimit species and species-groups with minimal noise (Heraty 2004; Polaszek et al. 2009). Sequences were aligned with MAFFT (v. 7.429) (Katoh et al. 2013) using the E-INS-i algorithm. The best nucleotide substitution model was selected with ModelFinder (Kalyaanamoorthy et al. 2017), and branch support was estimated by 1000 ultrafast bootstrap replicates with the –bnni flag enabled to reduce the negative impact of model violations (Hoang et al. 2018). We performed 25 independent tree searches and present the tree with the best (greatest) log-likelihood score. Two coccophagine aphelinids were selected as outgroups: Coccophagoides fuscipennis (Girault) (GenBank: AF254248.1) and Pteroptrix chinensis (Howard) (GenBank: KF778628.1).

Databasing

The specimens listed in the Material Examined section of the species description have been accessioned in The Ohio State University’s Museum of Biological Diversity database (https://mbd-db.osu.edu/). The numbers prefixed with “OSUC” are unique identifiers for the individual specimens. Details of the data associated with these specimens may be accessed at the above URL by entering the unique specimen identifier (e.g., OSUC 863846) in the form (note the blank space after the acronym).

Morphology

Morphological terminology follows Schmidt and Polaszek (2007). Relative lengths of morphological features were taken from the slide-mounted holotype and paratype as depicted in Heraty and Polaszek (2000).

Imaging

Slide-mounted specimens were imaged with a Keyence BZ-X810. Photographs of card-mounted insects were captured using a Macroscopic Solutions Macropod Micro Kit, with optical slices rendered in Helicon Focus. Composite images from each imaging system were imported into Adobe Photoshop 2022 to correct for brightness and contrast.

Collections

The slide-mounted holotype (OSUC 863846) and paratype (OSUC 863847) of E. hera, sp. nov., are deposited in the Smithsonian National Museum of Natural History (USNM), Washington, DC, USA. The two card-mounted paratypes (OSUC 863886; OSUC 863887) are deposited in the Florida State Collection of Arthropods (FSCA), Gainesville, Florida, USA.

Results

Taxonomy

Encarsia hera Lahey & Andreason, sp. nov.

https://zoobank.org/3C75DFAF-5FFF-44A1-947F-E34DF7F9DF3C
Figs 1–3, 4, 5

Species-group placement

Encarsia luteola-group.

Diagnosis

Encarsia hera, sp. nov., can be differentiated from other members of the E. luteola-group by outstanding coloration of the mesoscutellum and metasoma. Most E. luteola-group species have a concolorous mesoscutellum and a predominately yellow metasoma. Encarsia hera, sp. nov., differs from these species by the paired brown patches in the posterior half of the mesoscutellum and the predominantly brown metasoma of the female. Encarsia guadeloupae Viggiani also has a dark metasoma; however, in that species T1 is completely dark and the clava is 2-merous, whereas the lateral portions of T1 are yellow and the clava is 3-merous in E. hera, sp. nov.

Figures 1–3. 

Encarsia hera Lahey & Andreason, female holotype (OSUC 863846) 1 Antenna, lateral view 2 Mesotarsus, dorsal view 3 Fore wing, lateral view. Scale bars in millimeters.

Figure 4. 

Encarsia hera Lahey & Andreason, female paratype (OSUC 863886), habitus, dorsal view. Scale bar in millimeters.

Description

(female). Coloration. Body: predominately dark brown. Head: dark brown, except for pale areas on frons adjacent to compound eyes and a transverse strip on vertex anterior to ocellar bars. Antenna: yellow, except for fuscous apical clavomere (F6). Mesosoma: dark brown, except for yellow lateral and posteromedial margin of mesoscutum, mesoscutal side lobe, anterodorsal portion of acropleuron, and most of mesoscutellum. Mesoscutellum: predominately yellow with two conspicuous brown spots in posterolateral half. Fore and hind wings: hyaline, venation fuscous. Legs: pale yellow, except for fuscous apical tarsomere (tarsomeres 4 + 5 fused) on midleg and apical three tarsomeres on hindleg. Metasoma: dark brown, except for lateral portions of T1 which appear transparent/opalescent. Ovipositor: third valvulae yellow.

Head. Antennal formula: 1-1-3-3. Length of pedicel relative to F1: 0.8. Length of F1 relative to F2: 0.9. Length of F2 relative to F3: approximately equal. Number of multiporous plate sensilla on F1–F6: 1-2-2-3-3-3. Sculpture of stemmaticum: aciculate. Sculpture of frons ventral to transfacial line: indiscernible. Sculpture of frons dorsal to transfacial line: transversely imbricate.

Mesosoma. Number of setae on midlobe of mesoscutum: 16. Number of setae on side lobe of mesoscutum: 2. Number of setae on axilla: 1. Proximity of campaniform sensilla on mesoscutellum: ≥ 5 sensillar widths apart. Distance between anterior pair of mesoscutellar setae: equal to distance between posterior pair of mesoscutellar setae. Length of mesoscutellar setae: anterior pair distinctly shorter than posterior pair. Tarsal formula: 5-4-5. Length of midtibial spur: 0.8× length of midbasitarsus.

Metasoma. Number of paired setae on T1–T6: 0-1-2-1-3-3. Length of ovipositor: 0.8× length of midtibia. Apical portion of 3rd valvulae: chisel-tipped, inner margin longer than outer margin. Length of 3rd valvulae relative to 2nd valvifer: 0.7×.

Wings. Length of fore wing: 2.7× width. Asetose area below stigma vein: absent. Length of marginal fringe: 0.3× maximum width of disc. Number of setae in basal cell region: 5. Arrangement of setae in basal cell: linear, originating and forming a 45° angle with submarginal vein. Number of setae on submarginal vein: 2. Number of setae along anterior of marginal vein: 8; 9.

Description

(male). Coloration. Same as female, except for the darker mesoscutellum and T1 is dark throughout.

Morphology. Sculptural patterns very similar to female. Mesoscutellar sculpture: weak medially, large reticulations laterally. Number of antennomeres: 8. Condition of F6: articulate with F5, not fused or partially fused.

Distribution

Florida (USA).

Host

Aleurocybotus sp. nr. cereus (Hemiptera: Aleyrodidae).

Etymology

Named for the Hera of Greek mythology, one of the Twelve Olympians, Queen of the Gods, and protector of women from harm during childbirth.

Material Examined

Holotype , female: USA: Florida, Gainesville, 29°36'3"N, 82°25'13"W, 19.vi.2022, ex. Aleurocybotus n. sp. on ornamental Muhly grass (Muhlenbergia capillaris), Z. Lahey, OSUC 863846 (deposited in USNM). Paratypes: USA: collection data identical to holotype, 1 female, 2 males, OSUC 863847 (USNM); OSUC 863886, 863887 (FSCA).

Phylogenetic analyses

The alignment of the 28S-D2-3 region in the 36 taxa was 1,037 characters long (base pairs plus gaps) and the model of nucleotide evolution was SYM+I+G4. In all analyses, the E. luteola-group was recovered as monophyletic with maximum ultrafast bootstrap support (UFBS = 100; Fig. 9). Encarsia hera, sp. nov., was nested within the E. luteola-group, as the sister taxon to E. formosa Gahan (UFBS = 99; Fig. 9), and E. luteola Howard was recovered as the sister taxon to E. hera sp. nov. + E. formosa (UFBS = 95; Fig. 9). An expanded analysis of the same gene region with additional Encarsia species recovered the same sister group relationships between E. luteola, E. hera sp. nov., and E. formosa as those in Fig. 9 (Suppl. material 1), as did a trimmed version (495 characters) of the original dataset (Suppl. material 2). While this article was in press, we were alerted that two taxa (three sequences) used in the phylogenetic analyses are misidentified in GenBank. The sequences corresponding to accessions AF223366.1 and AF223367.1 belong to E. californica Polaszek and AY360217.1 corresponds to E. dispersa Polaszek. Both E. meritoria Gahan and E. haitiensis Dozier have never been sequenced (A. Polaszek, pers. comm.).

Figure 5. 

Encarsia hera Lahey & Andreason, male paratype (OSUC 863887), habitus, dorsolateral view. Scale bar in millimeters.

Comments

Members of the E. luteola-group are recognized by having 4 mesotarsal segments and a fully setose wing disc (Gahan 1924; Polaszek et al. 1992). This species group has been recovered as monophyletic in several phylogenetic analyses of 28S rDNA (Babcock et al. 2000; Schmidt et al. 2006), although no analysis has yet to include all described species.

The sister group relationship between E. formosa and E. hera, sp. nov., recovered in our study breaks the longstanding paradigm that E. formosa and E. luteola are likely each other’s most closely related living relative (Babcock and Heraty 2000). This is an interesting finding given the morphological similarity between the two taxa, with certain specimens impossible to distinguish as either species (Polaszek et al. 1992). Schauff et al. (1996) even mentioned the possibility that E. formosa and E. luteola are conspecific based on the lack of morphological characters that can readily define them. Our analysis brings to light at least one character mentioned by Babcock and Heraty (2000) that allows for the unambiguous identification of E. formosa: the presence of multiporous plate sensilla (MPS) on funicle (F) 1 and 2. Encarsia hera, sp. nov., also possesses this character, whereas E. luteola lacks MPS on F1 and F2, lending morphological credence to the relationships between these three taxa recovered in the molecular analysis.

Figures 6–8. 

Encarsia longitarsis Myartseva, female paratype 6 Mesoscutellum, dorsal view 7 Antennal clava, lateral view, with arrow at the constriction between the last funicular and first claval segment 8 Metasoma, dorsal view, coloration of lateral metasoma boxed in white. Scale bars in millimeters.

Key to species of Encarsia Förster reared from Aleurocybotus Quaintance & Baker

1 Tarsus of midleg 5-merous; head, mesosoma, and metasoma yellow Encarsia protransvena Silvestri
– Tarsus of midleg 4-merous (Fig. 2); head and mesosoma completely or partially dark (Figs 4, 5) 2
2 Mesoscutellum with two brown markings in posterior half (Fig. 4); clava 3-merous (Fig. 1) Encarsia hera Lahey & Andreason, sp. nov.
– Mesoscutellum concolorous throughout (Fig. 6); clava 2-merous (Fig. 7) 3
3 Dorsolateral surface of metasoma light yellow, concolorous with remainder of metasoma Encarsia luteola Howard
– Dorsolateral surface of metasoma brown, contrasting with remainder of metasoma (Fig. 8) Encarsia longitarsis Myartseva
Figure 9. 

Maximum likelihood phylogeny of the 28S-D2-3 region in 34 Encarsia and two outgroup species. The number under the scale bar indicates the number of expected nucleotide substitutions per site. Ultrafast bootstrap supports values are indicated by colored circles at nodes. GenBank accession numbers beginning with OP correspond to specimens newly sequenced for this study.

Discussion

The arthropod fauna of Florida is in a constant state of flux, notably because of its position as a botanical import hub of the countries that comprise the Caribbean, South America, Europe, and Asia (Stocks 2013). Each of these regions harbors exotic whitefly species with the potential to become invasive and effect economic losses in the United States. The provenance of the new species of Aleurocybotus, first found in Florida, and now found in South Carolina, as well as its parasitoid, is uncertain. The earliest collections of this whitefly are from January 1988 in Wabasso, Florida, on Muhly grass (L. Deeter, pers. comm.). Muhly grass is a common perennial ornamental that is native to eastern North America and is the only reported host of this whitefly species.

The evidence for the undescribed whitefly as adventive is based on a comparison of its morphology with other described species of the genus. Puparia of the new Aleurocybotus secrete copious amounts of flocculent wax, a characteristic exhibited by both A. cereus and A. mojavensis von Ellenrieder & Bailey, species from Belize and California, respectively (Martin 2005; von Ellenrieder and Bailey 2022). These species share a glandular zone on the dorsal submedian area of the nymphal stages that is not present in either named species known to occur in Florida (von Ellenrieder and Bailey 2022).

Surveys of parasitoid Hymenoptera primarily associated with Bemisia Quaintance & Baker in Florida, the Caribbean, and Latin America failed to recover E. hera, sp. nov., from that host (Stansly et al. 1997; Schuster et al. 1998). Lahey (2014) built upon these efforts by expanding the taxon sampling to additional whitefly genera in Florida. Encarsia hera, sp. nov., was not reared from the 13 non-Bemisia genera collected over a 6-year period, but these collections did not include Aleurocybotus (Lahey 2014; Stocks 2016; Lahey and Polaszek 2017). Given that this parasitoid has not been reared from any other whitefly genus in Florida, it apparently established with its host on infested plant material and has persisted since the original introduction, sometime before 1988. Alternatively, E. hera, sp. nov., may be a recent introduction or have expanded its host range to include Aleurocybotus. Testing either hypothesis will require continued sampling of whiteflies and their parasitoids from a broad geographic range.

The discovery of a new Encarsia species is not surprising. Encarsia is the most speciose genus in the family Aphelinidae and has been labeled ‘megadiverse’ based on a suite of morphological, genetic, and biological characteristics that account for the estimated 4,000 plus species thought to exist in nature (Polaszek et al. 2009). This estimate may even be considered conservative in that it does not consider the lack of knowledge regarding the biodiversity of their hosts, mostly whiteflies (approx. 1,600 described species; Martin and Mound 2007) and armored scale insects (2,700 described species; García Morales et al. 2016), new species of which are frequently uncovered. Based on these numbers and that Florida is home to the most diverse assemblage of whiteflies in the United States, we expect the number of new Encarsia and whiteflies to grow as scouting for these economically important pests, and their natural enemies, continues.

Acknowledgements

We thank Greg Evans (USDA-APHIS) and Natalia von Ellenrieder (California Department of Food and Agriculture) for confirming the species status of the Aleurocybotus specimens from Florida and South Carolina. Lily Deeter (FDACS-DPI-FSCA) kindly provided a tally for the number of whitefly genera and species in Florida, and Natalia von Ellenrieder did the same for California. Andrew Polaszek (Natural History Museum) is thanked for discussions on the morphology of Encarsia, the status of the E. luteola-group, and for constructive criticism during the review process. Luke Kresslein (University of California, Riverside) is thanked for taking images of the E. longitarsis paratype. Petr Janšta (Naturkundemuseum Stuttgart) kindly handled the review process and provided valuable feedback. The first author is a participant of the Oak Ridge Institute for Science and Education (ORISE) Agricultural Research Service (ARS) Research Participation Program, supported by the USDA-ARS, U.S. Vegetable Laboratory in Charleston, SC, USA. This work has been funded by the USDA. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the USDA.

References

  • Andreason SA, Triapitsyn SV, Perring TM (2019) Untangling the Anagyrus pseudococci species complex (Hymenoptera: Encyrtidae), parasitoids of worldwide importance for biological control of mealybugs (Hemiptera: Pseudococcidae): genetic data corroborates separation of two new, previously misidentified species. Biological Control 129: 65–82. https://doi.org/10.1016/j.biocontrol.2018.09.010
  • Babcock CS, Heraty JM, De Barro PJ, Driver F, Schmidt S (2001) Preliminary phylogeny of Encarsia Förster (Hymenoptera: Aphelinidae) based on morphology and 28S rDNA. Molecular Phylogenetics and Evolution 18: 306–323.
  • Clausen CP, Berry PA (1932) The citrus blackfly in Asia, and the importation of its natural enemies into Tropical America. US Department of Agriculture Technical Bulletin 320: 1–58.
  • Evans GA, Polaszek A, Bennett FD (1995) The taxonomy of the Encarsia flavoscutellum species-group (Hymenoptera: Aphelinidae) parasitoids of Hormaphididae (Homoptera: Aphidoidea). Oriental Insects 29: 33–45. https://doi.org/10.1080/00305316.1995.10433740
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Fusu L, Polaszek A (2017) Description, DNA barcoding and phylogenetic placement of a remarkable new species of Eopelma (Hymenoptera: Eupelmidae) from Borneo. Zootaxa 4263: 557–566. https://doi.org/10.11646/zootaxa.4263.3.7
  • García Morales M, Denno BD, Miller DR, Miller GL, Ben-Dov Y, Hardy NB (2016) ScaleNet: a literature-based model of scale insect biology and systematics. Database 2016: bav118. https://doi.org/10.1093/database/bav118
  • Hart WG, Selhime A, Harlan DP, Ingle SJ, Sanchez RM, Rhode RH, Garcia CA, Caballero J, Garcia RL (1978) The introduction and establishment of parasites of citrus blackfly, Aleurocanthus woglumi in Florida [Hem.: Aleyrodidae]. Entomophaga 23: 361–366. https://doi.org/10.1007/BF02373053
  • Heraty JM, Polaszek A (2000) Morphometric analysis and descriptions of selected species in the Encarsia strenua group (Hymenoptera: Aphelinidae). Journal of Hymenoptera Research 9: 142–169.
  • Heraty JM, Polaszek A, Schauff ME (2008) Systematics and biology of Encarsia. In: Gould J, Hoelmer K, Goolsby J (Eds) Classical biological control of Bemisia tabaci in the United States – a review of interagency research and implementation. Progress in Biological Control 4: 71–87. https://doi.org/10.1007/978-1-4020-6740-2_4
  • Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. https://doi.org/10.1093/molbev/msx281
  • Kalyaanamoorthy S, Minh BQ, Wong TK, von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Lahey ZJ (2014) Parasitoids of an invasive Bemisia tabaci species (Hemiptera: Aleyrodidae) in southwest Florida: faunal composition, host-plant associations, and interspecific competition. Master’s Thesis. University of Florida, Gainesville, Florida.
  • Lahey ZJ, Polaszek A (2017) Baeoentedon balios (Hymenoptera: Eulophidae): a parasitoid of ficus whitefly, Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), new to the United States. International Journal of Pest Management 63: 349–351. https://doi.org/10.1080/09670874.2016.1269222
  • Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R (2020) IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37: 1530–1534. https://doi.org/10.1093/molbev/msaa015
  • Myartseva SN, Ruíz-Cancino E (2010) Una nueva especie de Metaphycus Mercet (Hymenoptera: Encyrtidae) de México y clave de especies del género que parasitan mosquitas blancas (Hemiptera: Aleyrodidae) en la región neotropical. Acta Zoológica Mexicana 26: 17–24. https://doi.org/10.21829/azm.2010.261676
  • Myartseva SN, Vejar-Cota G, Cortez-Mondaca E (2009) A new species of the genus Encarsia (Hymenoptera: Aphelinidae) – parasitoid of Aleurocybotus occiduus Russell (Hemiptera: Aleyrodidae) from Mexico. Russian Entomological Journal 18: 123–126.
  • Nunn GB, Theisen BF, Christensen B, Arctander P (1996) Simplicity correlated size growth of the nuclear 28S ribosomal RNA D3 expansion segment in the crustacean order Isopoda. Journal of Molecular Evolution 42: 211–223. https://doi.org/10.1007/BF02198847
  • Park JK, O’Foighil D (2000) Sphaeriid and corbiculid clams represent separate heterodont bivalve radiations into freshwater environments. Molecular Phylogenetics and Evolution 14: 75–88. https://doi.org/10.1006/mpev.1999.0691
  • Polaszek A (1991) Egg parasitism in Aphelinidae (Hymenoptera: Chalcidoidea) with special reference to Centrodora and Encarsia species. Bulletin of Entomological Research 81: 97–106. https://doi.org/10.1017/S0007485300053293
  • Polaszek A, Evans GA, Bennett FD (1992) Encarsia parasitoids of Bemisia tabaci (Hymenoptera: Aphelinidae, Homoptera: Aleyrodidae): a preliminary guide to identification. Bulletin of Entomological Research 82: 375–392. https://doi.org/10.1017/S0007485300041171
  • Polaszek A, Hernández-Suárez EM, Manzari S, Pedata PA, Schmidt S (2009) Megadiversity of Encarsia (Chalcidoidea, Aphelinidae): macroevolution in a microhymenopteran. Memoria de Taller Internacional sobre Recursos Naturales 21: 87–92.
  • Polaszek A, Gill R (2011) A new species of whitefly (Hemiptera: Aleyrodidae) and its parasitoid (Hymenoptera: Aphelinidae) from desert lavender in California. Zootaxa 2750: 51–59. https://doi.org/10.11646/zootaxa.2750.1.5
  • Polaszek A, Albarracin EL (2011) Two new Encarsia species (Hymenoptera: Aphelinidae) reared from eggs of Cicadellidae (Hemiptera: Auchenorrhyncha) in Argentina: an unusual new host association. Journal of Natural History 45: 55–64. https://doi.org/10.1080/00222933.2010.520169
  • Polaszek A, Ayshford T, Effendi B, Fusu L (2013) Wallaceaphytis: an unusual new genus of parasitoid wasp (Hymenoptera: Aphelinidae) from Borneo. Journal of Natural History 48: 1111–1123. https://doi.org/10.1080/00222933.2013.852264
  • Polaszek A, Al-Riyami A, Lahey Z, Al-Khatri SA, Al-Shidi RH, Hardy ICW (2021) Telenomus nizwaensis (Hymenoptera: Scelionidae), an important egg parasitoid of the pomegranate butterfly Deudorix livia Klug (Lepidoptera: Lycaenidae) in Oman. PLoS ONE 16: e0250464. https://doi.org/10.1371/journal.pone.0250464
  • Polaszek A, Fusu L, Viggiani G, Hall A, Hanson P, Polilov AA (2022) Revision of the world species of Megaphragma Timberlake (Hymenoptera: Trichogrammatidae). Insects 13: 561. https://doi.org/10.3390/insects13060561
  • Russell LM (1964) A new species of Aleurocybotus (Homoptera: Aleyrodidae). Proceedings of the Entomological Society of Washington 66: 101–102.
  • Russell LM (2000) Notes on the family Aleyrodidae and its subfamilies: redescription of the genus Aleurocybotus Quaintance and Baker and description of Vasdavidius, a new genus (Homoptera: Aleyrodidae). Proceedings of the Entomological Society of Washington 102: 374–383.
  • Sailer RI, Brown RE, Munir B, Nickerson JCE (1984) Dissemination of the citrus whitefly (Homoptera: Aleyrodidae) parasite Encarsia lahorensis (Howard) (Hymenoptera: Aphelinidae) and its effectiveness as a control agent in Florida. Bulletin of the Entomological Society of America 30: 36–39. https://doi.org/10.1093/besa/30.2.36
  • Schmidt S, Driver F, De Barro P (2006) The phylogenetic characteristics of three different 28S rRNA gene regions in Encarsia (Insecta, Hymenoptera, Aphelinidae). Organisms Diversity & Evolution 6: 127–139. https://doi.org/10.1016/j.ode.2005.07.002
  • Schmidt S, Polaszek A (2007) The Australian species of Encarsia Förster (Hymenoptera, Chalcidoidea: Aphelinidae), parasitoids of whiteflies (Hemiptera, Sternorrhyncha, Aleyrodidae) and armoured scale insects (Hemiptera, Coccoidea: Diaspididae). Journal of Natural History 41: 2099–2265. https://doi.org/10.1080/00222930701550766
  • Schuster DJ, Evans GA, Bennett FD, Stansly PA, Jansson RK, Leibee GL, Webb SE (1998) A survey of the parasitoids of Bemisia spp. whiteflies in Florida, the Caribbean, and Central and South America. International Journal of Pest Management 44: 255–260. https://doi.org/10.1080/096708798228194
  • Stansly PA, Schuster DJ, Liu T-X (1997) Apparent parasitism of Bemisia argentifolii (Homoptera: Aleyrodidae) by Aphelinidae (Hymenoptera) on vegetable crops and associated weeds in south Florida. Biological Control 9: 49–57. https://doi.org/10.1006/bcon.1997.0504
  • Stocks I (2013) Recent adventive scale insects (Hemiptera: Coccoidea) and whiteflies (Hemiptera: Aleyrodidae) in Florida and the Caribbean region. In: Peña JE (Ed.) Potential invasive pests of agricultural crops. CABI International, Wallingford (UK), 342–362. http://doi.org/10.1079/9781845938291.0342
  • Stocks I (2016) A new continental record whitefly in Florida. Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Pest Alert. FDACS-P-02066.
  • von Ellenrieder N, Bailey J (2022) Aleurocybotus mojavensis (Hemiptera: Sternorrhyncha: Aleyrodidae), a new whitefly species from California. Zootaxa 5174: 294–300. https://doi.org/10.11646/zootaxa.5174.3.7
  • Whiting MF, Carpenter JC, Wheeler QD, Wheeler WC (1997) The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Systematic Biology 46: 1–68. https://doi.org/10.2307/2413635

Supplementary materials

Supplementary material 1 

Maximum likelihood cladogram of the 28S-D2-3 region in 71 Encarsia and two outgroup species (1,070 sites, SYM+R3)

Zachary Lahey, Alvin M. Simmons, Sharon A. Andreason

Data type: image (svg file)

Explanation note: Maximum likelihood cladogram of the 28S-D2-3 region in 71 Encarsia and two outgroup species (1,070 sites, SYM+R3). Ultrafast bootstrap supports values are indicated on branches. GenBank accession numbers beginning with OP correspond to specimens newly sequenced for this study. Branches in red correspond to members of the E. luteola­-group.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (90.76 kb)
Supplementary material 2 

Maximum likelihood cladogram of a trimmed version of the 28S-D2-3 dataset analyzed in Fig. 9 (495 sites, GTR+F+G4)

Zachary Lahey, Alvin M. Simmons, Sharon A. Andreason

Data type: image (svg file)

Explanation note: Maximum likelihood cladogram of a trimmed version of the 28S-D2-3 dataset analyzed in Fig. 9 (495 sites, GTR+F+G4). Ultrafast bootstrap supports values are indicated on branches. GenBank accession numbers beginning with OP correspond to specimens newly sequenced for this study. Branches in red correspond to members of the E. luteola­-group.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (35.31 kb)
login to comment