Monograph
Print
Monograph
A maximalist approach to the systematics of a biological control agent: Gryon aetherium Talamas, sp. nov. (Hymenoptera, Scelionidae)
expand article infoElijah J. Talamas, Jonathan S. Bremer, Matthew R. Moore, Marie-Claude Bon§, Zachary Lahey|, Cheryl G. Roberts, Lynn A. Combee, Natalie McGathey, Simon van Noort, Alexander V. Timokhov#, Evelyne Hougardy¤, Brian Hogg¤
‡ Florida Department of Agriculture and Consumer Services, Gainesville, United States of America
§ USDA-ARS-EBCL, Montpellier, France
| The Ohio State University, Columbus, United States of America
¶ Iziko South African Museum, Cape Town, South Africa
# Lomonosov Moscow State University, Moscow, Russia
¤ USDA-ARS-ISPH, Albany, United States of America
Open Access

Abstract

A morphological and molecular analysis of Gryon Haliday (Platygastroidea, Scelionidae) was conducted to provide a taxonomic and phylogenetic context for a species under evaluation as a biological control agent of Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae). Our analysis revealed that Gryon is polyphyletic and that the biological control agent is not G. gonikopalense, a name that was tentatively applied to this species in 2019. We here describe this species as new, Gryon aetherium Talamas sp. nov., and resurrect the generic name Hadronotus Förster. Morphological characters that delimit our concepts of Gryon and Hadronotus are presented. Based on morphological characters and multilocus phylogenies, we determined that five presently valid scelionid genera belong within Gryon. In total, 15 species are transferred into Gryon from these genera, 215 species are transferred from Gryon to Hadronotus, and 6 species are transferred from Gryon to Dyscritobaeus Perkins. Specimens collected during field studies in California and reevaluation of specimens determined as G. myrmecophilum in Mexico reveal that G. aetherium is adventive in North America.

Keywords

Gryon, taxonomy, bagrada bug

Introduction

Bagrada bug, Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae), is an agriculturally destructive pest that has invaded North and South America (Palumbo and Natwick 2010; Bundy et al. 2012; Reed et al. 2013; Sánchez-Peña 2014; Faúndez et al. 2016; Palumbo et al. 2016). It is a pest of several brassicaceous crops and ornamental plants (Palumbo and Natwick 2010; Reed et al. 2013) and young seedlings are particularly vulnerable to feeding damage (Huang et al. 2014). Current control practices rely mostly on conventional insecticides which lead to increased production costs and negative impacts on natural enemies and human health (Stark and Banks 2003). Initial surveys in northern and central California, where most of the nation’s brassicaceous crops are grown, found that parasitoids attacked far less than 1% of sentinel eggs that were deployed (B. Hogg, unpublished data). The unique oviposition behavior of B. hilaris, the only pentatomid species known to bury its eggs in the soil (Taylor et al. 2014), is a likely factor in limiting the efficacy of natural enemies in newly invaded regions.

Economic consequences caused by the bagrada bug were at times severe, with 53 certified organic cole crop farms in California reporting losses of $25,000 to $100,000 from bagrada bug in 2014–2015, resulting in total annual losses of $1.3 to 5.3 million for these farms alone (California Certified Organic Farmers, personal communication). This prompted the initiation of a biological control program that imported egg parasitoids from Pakistan (Mahmood et al. 2015), the most likely origin of the invasive B. hilaris population in the United States (Sforza et al. 2017), into quarantine facilities for host range testing. Two of the most promising species were egg-parasitoid wasps in the family Scelionidae: Trissolcus hyalinipennis Rajmohana & Narendran and a species of Gryon Haliday. The recent revision of Trissolcus Ashmead in the Palearctic region (Talamas et al. 2017a) made identification of the former a straightforward task, demonstrating the value of taxonomic preparedness as discussed by Buffington et al. (2018).

Regarding taxonomic preparedness in Gryon, the North America fauna was revised by Masner (1983) but thorough and methodical treatments at the species-level are lacking for most other parts of the world. This created a challenge for identifying the Gryon species (G. aetherium Talamas) that stood out as a promising classical biocontrol agent because of its ability to parasitize 25–55% of the eggs laid in the soil in laboratory settings (Tofangsazi et al. 2020; Martel and Sforza 2021). This species was initially identified by the first author as Gryon gonikopalense Sharma, based on the proximity of the collecting locality of the holotype (India) to that of the biological control agent (Pakistan), and the apparent congruence of morphology among the specimens examined. However, G. gonikopalense was originally described from a single specimen (Figures 77–78), precluding evaluation of intraspecific variability or characters that are obscured by glue or missing from the holotype specimen (e.g., wings). Martel et al. (2019) mentioned that the name of the biocontrol agent might change as the taxonomy of Gryon improved and alerted readers to this possibility. The name G. gonikopalense has since been used in Tofangsazi et al. (2020), Martel and Sforza (2021), Hougardy and Hogg (2021) and Martel et al. (2021).

As the project progressed, the morphological similarity between species and the appearance of vast geographical ranges for some Gryon species made it clear that this identification needed to be verified with a more intensive analysis that included both molecular data and a broader examination of specimens. The former had the potential to determine if Gryon could be separated into morphologically identifiable, monophyletic species groups and so representatives from throughout the genus were analyzed. Some characters that we found to be important for diagnosis were not used by previous workers, thus requiring a fresh examination of primary types to correctly characterize and place species. Given the species richness of Gryon, this is a laborious, ongoing task that is essential for advancing its taxonomy. It has required travel on five continents and nearly five years to make a reasonably confident statement about the identity of the parasitoid species in question.

Scelionid parasitoids of Bagrada hilaris

Field studies in North America reported seven species of scelionid wasps associated with bagrada bug eggs. Four species of Trissolcus were reared in southern California: Trissolcus basalis (Wollaston), Tr. hullensis (Harrington), Tr. utahensis (Ashmead), and the adventive Tr. hyalinipennis (Ganjisaffar et al. 2018, 2020). In Mexico, a more diverse assemblage of scelionids was recovered from bagrada bug eggs: Idris elba Talamas, Telenomus podisi Ashmead, Tr. basalis, and a species of Gryon that was initially determined by the first author as G. myrmecophilum (Ashmead) (Felipe-Victoriano et al. 2019; Lomeli-Flores et al. 2019). However, as Felipe-Victoriano et al. (2019) noted, the COI sequences of specimens reared from bagrada eggs in Mexico were highly divergent from G. myrmecophilum collected elsewhere on the continent. We here reevaluate and correct the identifications of the Gryon species under consideration as a biological control agent and the specimens reared from bagrada eggs in Mexico. This is done considering multiple sources of evidence that include molecular and morphological analyses of specimens from a broad geographical area, comparison to primary types, evaluation of host-related variability, and crossbreeding experiments conducted by Hogg et al. (2021).

A brief history of Gryon

Gryon was erected by Haliday (1833), making it among the earliest genera described in Scelionidae. Two decades later, Förster (1856) described Acolus and Hadronotus in the same publication. Seven years after this, Motschoulsky (1863) described the monotypic Muscidea. Thirteen generic names that are junior synonyms of Gryon were described during the 20th century, of which 11 were described between 1908 and 1926 (Table 5). Hadronotus Förster remained a valid genus until Masner (1961) treated it as a junior synonym of Gryon, stating that the characters provided by Förster (1856) and Maneval (1940) were unreliable for separating the two genera. Gryon has since been treated as a polytypic taxon in which numerous species groups have been established to provide some level of subgeneric classification for well over 300 species.

Many taxonomic treatments of Gryon have been limited in scope, whereas large-scale syntheses are needed to manage a genus of its size. This situation made it clear that major reassessments of its limits and constituent species were needed, including detailed characterization of historic type specimens. We thus prioritized the examination and imaging of primary types. For species whose type material we have yet to examine, we relied on original descriptions for generic placement. This process revealed that many original descriptions are woefully inadequate, and some are so brief that they can hardly be considered the result of serious taxonomic study. Unfortunately, this phenomenon is not limited to Gryon and many taxa in Platygastroidea are plagued by a casual approach to assigning names to species.

Species groups

One of our initial goals was to delimit species groups within Gryon to facilitate revisionary projects of more manageable size. This task is beyond the scope of the current treatment. However, we are confident that our phylogenetic analyses provide a significant step toward a subgeneric classification and preliminary examination has revealed numerous morphological characters that warrant further study.

The maximalist approach

We term our approach to the systematics of G. aetherium as “maximalist” for a few reasons. First, we employed biological, morphological, and molecular species datasets in the delimitation of this species and experimentally assessed the effect of host species on intraspecific variation. This level of analysis is rarely conducted in the original description of species, and though likely not feasible for many taxa, it is warranted by the the economic and agricultural significance of G. aetherium. Second, we have simultaneously made every effort to overcome the “superficial description impediment” sensu Meier et al. (2021) to accelerate and facilitate future work on Gryon and Hadronotus. To this end, we have established new character systems that are informative at the levels of genus and species and demonstrated the utility of the molecular markers used in our phylogenies. We have made freely available all data for species that are actively under study, including images of all primary types examined (>150) and images of all Gryon and Hadronotus species that we sequenced for molecular analyses. Lastly, we use the term “maximalist” because our approach may be considered a counterpoint to the recent “minimalist revision” of Sharkey et al. (2021).

Material and methods

Collections

Specimens on which this work is based are deposited in the following repositories with abbreviations used in the text:

ANIC Australian National Collection of Insects, Canberra, Australia

CASC California Academy of Sciences, San Francisco, California, USA

CDFA California Department of Food and Agriculture, Sacramento, California, USA

CNCI Canadian National Collection of Insects, Ottawa, Canada

EMEC Essig Museum of Entomology, Berkeley, California, USA

FSCA Florida State Collection of Arthropods, Gainesville, Florida, USA

HNHM Hungarian Natural History Museum, Budapest, Hungary

ICIPE International Centre of Insect Physiology and Ecology, Nairobi, Kenya

IEBR Institute of Ecology and Biological Resources, Hanoi, Vietnam

MCSN Museo Civico di Storia Naturale “Giacomo Doria”, Genoa, Italy

MFNB Museum für Naturkunde Berlin, Berlin, Germany

MNHN Muséum national d’Histoire naturelle, Paris, France

MZLU Lund Museum of Zoology, Lund, Sweden

NHMW Naturhistorisches Museum Wien, Vienna, Austria

NHM Natural History Museum, London, England

OSUC C.A. Triplehorn Insect Collection, The Ohio State University, Columbus, Ohio, USA

SAMA South Australian Museum, Adelaide, Australian

SAMC Iziko Museums of South Africa, Cape Town, South Africa

SNU College for Agriculture and Life Sciences, Seoul National University, Seoul, South Korea

UASK Ukrainian Academy of Science, Kiev, Ukraine

UCFC University of Central Florida Collection of Arthropods, Orlando, Florida, USA

UCRC Entomological Research Museum, University of California, Riverside, California, USA

USNM National Museum of Natural History, Smithsonian Institution, Washington, DC, USA

ZMMU Zoological Museum, Lomonosov Moscow State University, Moscow, Russia

Multilocus phylogeny

Extraction, amplification, and sequencing were performed at the European Biological Control Laboratory (EBCL) and the Florida State Collection of Arthropods (FSCA). Genomic DNA was nondestructively isolated from entire specimens using the Qiagen DNeasy kit (Hilden, Germany) as published in Taekul et al. (2014) with the modifications specified in Sabbatini Peverieri et al. (2018). Vouchers from extractions at EBCL were shipped in absolute ethanol to FSCA for further morphological examination. All residual gDNAs are archived at EBCL and FSCA. Amplification procedures, including thermocycling conditions for COI, 18S rRNA, 28S rRNA, and Wingless, were done as described in Talamas et al. (2019) with primers provided in Table 1. Amplicon sequencing and sequence editing were done as described in Talamas et al. (2019).

Table 1.

PCR primers used in this study.

Primer Sequence (5’-3’) Citation
18S-H17F AAATTACCCACTCCCGGCA Heraty et al. (2004)
18S-H35R TGGTGAGGTTTCCCGTGTT
28S-D23F GAGAGTTCAAGAGTACGTG Park and Foighil (2000)
28S-b TCGGAAGGAACCAGCTACTA Whiting et al. (1997)
SceWgIF-1 GTAAGTGTCACGGGATGTC Chen et al. (2021)
SceWgIR-1 TTGACTTCACAGCACCAGT
LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCO2198 LCO1490puc HCO2198puc TAAACTTCAGGGTGACCAAAAAATCA TTTCAACWAATCATAAAGATATTGG TAAACTTCWGGRTGWCCAAARAATCA Cruaud et al. (2010)
LEP-F1 ATTCAACCAATCATAAAGATAT Hebert et al. (2004)
LEP-R1 C1-J-1632 C1-N-2191 TAAACTTCTGGATGTCCAAAAA TGATCAAATTTATAAT CCCGGTAAAATTAAAATATAAACTTC Kambhampati and Smith (1995) Simon et al. (1994)

PCRs targeted four loci: two nuclear ribosomal genes, 18S rRNA (variable region V3-V5) and the 28S rRNA (D2-D3 expansion regions), the nuclear gene Wingless (exon), and the mitochondrial 5’ end of the cytochrome c oxydase subunit I gene (COI), also named the barcode region. These loci were selected for their compatibility with previous datasets examining the relationships of platygastroid species across several taxonomic scales (Murphy et al. 2007; Taekul et al. 2014; Talamas et al. 2019; Chen et al. 2021).

The COI barcode was predominantly amplified using the primers of Folmer et al. (1994) and Hebert et al. (2004). When these did not amplify, we used the primers of Cruaud et al. (2010), Kambhampati and Smith (1995) and Simon et al. (1994).

PCRs utilized the KAPA HiFi HotStart Readymix Kit (Roche Diagnostics) per the manufacturer’s protocol in 25 µL reactions (Table 2). Amplicons were purified and prepared for sequencing with BigDye Terminator v.3.1 chemistry (Applied Biosystems). Sequence traces were trimmed in Sequencher 5.4.6. and assembled into contigs. Newly generated sequences were submitted to GenBank and their accession number are presented in Suppl. material 1 (highlighted in blue).

Table 2.

Thermocycle conditions.

Primers Thermocycle
18S-H17F/18S-H35R 1) 98C/3 min; 35× of steps 2–4: 2) 95C/30 sec; 3) 52C/45 sec; 4) 72C/1 min; 5) 72C/10 min; 4C/∞
28S-D23F/28S-b 1) 98C/3 min; 35× of steps 2–4: 2) 95C/30 sec; 3) 57C/45 sec; 4) 72C/1 min; 5) 72C/10 min; 4C/∞
SceWgIF-1/SceWgIR-1 1) 98C/3 min; 35× of steps 2–4: 2) 95C/30 sec; 3) 60C/30 sec; 4) 72C/1 min; 5) 72C/7 min; 4C/∞
LCO1490/HCO2198; LEP-F1/LEP-R1 1) 98C/3 min; 32× of steps 2–4: 2) 95C/30 sec; 3) 50C/30 sec; 4) 72C/45 sec; 5) 72C/7 min; 4C/∞
LCO1490puc/HCO2198puc 1) 94C/3 min; 10× of steps 2–4: 2) 94C/30 sec; 3) 48C/1 min; 4) 72C/1 min ; 30× of steps 2–4: 2) 94C/30 sec; 3) 50C/1 min; 4) 72C/1 min; 5) 72C/10 min; 4C/∞
C1-J-1632/C1-N-2191 1) 95C/2 min; 30× of steps 2–4: 2) 98C/20 sec; 3) 40C/30 sec; 4) 72C/ 30 sec; 5) 72C/7 min; 4C/∞

Probaryconus Kieffer was selected as the furthest scelionid outgroup to root the phylogenetic analyses based on the topologies of Chen et al. (2021). Diverse exemplar scelionid ingroups were included to place Gryon specimens within the context of the family (Suppl. material 1). Individual loci were aligned with MAFFT v.7.394 (Katoh and Standley 2013) using either the E-INS-i (18S, 28S) or L-INS-i (COI, Wingless) algorithms. The loci were then concatenated into a supermatrix and maximum likelihood phylogenetic analyses were performed with IQ-TREE v1.6.12 (Nguyen et al. 2015). Eight partitions were originally specified for the concatenated data matrix: one partition for each ribosomal gene (18S, 28S) and one partition for each codon position of COI and Wingless. Automated model selection and partition merging was performed with ModelFinder as implemented in IQ-TREE (MFP option; Kalyaanamoorthy et al. 2017), which reduced the number of partitions to seven (Table 3). We estimated branch support in our three analyses with two metrics: (1) the non-parametric bootstrap (Felsenstein 1985), (2) the ultrafast bootstrap in IQ-TREE (Hoang et al. 2018). The same concatenated supermatrix and partition file served as input in each analysis. Non-parametric bootstrap support was estimated from 100 bootstrap replicates and 25 independent tree runs. Ultrafast bootstrap support was estimated from 10,000 bootstrap replicates, with the -bnni flag specified to minimize potential model violations (Hoang et al. 2018a), Maximum parsimony tree searches of the concatenated multigene dataset were conducted in MPBoot (Hoang et al. 2018b) using default parsimony ratchet settings. Maximum parsimony support for nodes was assessed using 10,000 ultrafast bootstraps. The phylogenetic tree presented in Figures 13 text is the topology recovered from the IQ-TREE ultrafast bootstrap analysis (best tree from 10 independent runs), with UFBoot, non-parametric bootstrap, and MPBoot values indicated on the branches.

Table 3.

Results of the automated model selection analysis conducted on the loci used for phylogenetic inference.

Partition No. Locus Model
1 18S+wgl3 TN+F+R8
2 28S SYM+R5
3 coi1 GTR+F+R5
4 coi2 TVM+F+I+G4
5 coi3 GTR+F+R7
6 wgl1 SYM+I+G4
7 wgl2 SYM+G4

COI barcode analysis

The Barcode of Life Database (BOLD; Ratnasingham and Hebert 2007) was mined for additional Gryon sequences. This included all sequences identified as Gryon in the database. Each barcode generated during this study was queried to the BOLD identification engine. Hits that were returned with 94% or greater sequence similarity, regardless of the identification-level, were included in further analyses. The mined sequences’ corresponding BOLD BINs (Ratnasingham and Hebert 2013) containing specimen images and metadata were then examined to further evaluate their identification as Gryon (Suppl. material 5). Taxon sampling for COI analyses otherwise followed the scelionid multigene dataset scheme.

Initial COI alignments revealed several indel events across Scelionidae. The COI alignment contained 479 scelionid terminals. DNA sequences were translated into amino acids using the invertebrate mitochondrial translation table and aligned using the default settings of MUSCLE (Edgar 2004) as implemented in MEGAX (Kumar et al. 2018). Amino acids were back-translated to DNA for maximum-likelihood phylogenetic analysis in IQ-TREE v2.0.5 (Minh et al. 2020) on the XSEDE computing cluster as part of the CIPRES Science Gateway (Miller et al. 2010). Model selection was performed using ModelFinder (Kalyaanamoorthy et al. 2017) with a single partition. The best-fit model according to the Bayesian Information Criterion was GTR+F+I+G4. Node support was calculated using 2,000 ultrafast bootstrap replicates (Hoang et al. 2018). Tree files were edited in FigTree v1.4.3 (Rambaut 2012) to aesthetically arrange nodes. Scelionid COI amino acids were manually compared to the helix-loop annotations of the elaterid beetle Agrypnus murinus (L.) (GenBank accession KJ963738.1) (Pentinsaari et al. 2016). The location (helix or loop) of amino acid deletions was recorded and scored as a COI phenotype across the dataset.

Phylogenetic placement of Maruzza Mineo

While screening sequences for potential contaminants and after conducting the phylogenetic analyses presented in Figures 14, one of us (EJT) determined a specimen from Taiwan, originally identified as Hadronotus, to be Maruzza japonica Mineo (Figures 96–99) using the characters in Mineo (1982a). The only sequence data available for M. japonica was COI, which was not included in the COI phylogenetic dataset described above based on its placement in a preliminary phylogenetic analysis that identified it as a potential contaminant. The methods for this analysis follow those of the multi-gene scelionid phylogeny, except that taxon sampling was expanded to include specimens for which only COI sequences were available. Our motivation for reporting the results of this analysis is to propose an initial phylogenetic hypothesis for the placement of Maruzza within Platygastroidea and provide evidence that supports its status as a valid genus.

Imaging

Photographs were captured with multiple imaging systems: a Z16 Leica lens with a JVC KY-F75U digital camera using Cartograph and Automontage software; an Olympus BX51 compound microscope with a Canon EOS 70D digital SLR camera; and a Leica DM2500 compound microscope with a Leica DFC425 camera; and a Leica M165 compound microscope with a Leica DFC450 camera. Illumination was achieved with a lighting dome or with LED gooseneck lamps and mylar light dispersers. Images were rendered from Z-stacks with Automontage, Helicon Focus or Zerene Stacker. In some cases, multiple montage images were stitched together in Photoshop to produce larger images at high resolution and magnification.

Dissections for scanning electron microscopy were performed with a minuten probe and forceps. Body parts were mounted to a 12 mm slotted aluminum mounting stub (EMS Cat. #75220) using a carbon adhesive tab (EMS Cat. #77825-12) and sputter coated with approximately 70 nm of gold/palladium using Cressington 108 and Denton IV sputtercoaters. Micrographs were captured using a Hitachi TM3000 Tabletop SEM and a Phenom XL G2 Desktop SEM.

Data deposition and informatics

Results of the phylogenetic analyses and their corresponding sequence matrices and partition files have been deposited in Dryad (https://doi.org/10.5061/dryad.dbrv15f18).

The numbers prefixed with acronyms, e.g., “USNMENT” or “OSUC ”, are unique identifiers for the individual specimens (note the blank space after some acronyms). The data associated with CUIDs presented in this study are deposited at mbd-db.osu.edu (MBD). Morphological terms were matched to concepts in the Hymenoptera Anatomy Ontology (Yoder et al. 2010) using the text analyzer function. A table of morphological terms and URI links is provided in Suppl. material 4. The description of Gryon aetherium was generated from a matrix in the online program vSysLab (vsyslab.osu.edu) in the format of character: state.

Images of many primary types were made available by the Platygastroidea Planetary Biodiversity Inventory and the photographic catalogs of Talamas et al. (2017b) and Talamas and Pham (2017). For each species in which images are deposited in MBD, formerly the Hymenoptera Online Database (HOL), we provide collecting unit identifiers (CUIDs) that can be entered into the search form at mbd-p.asc.ohio-state.edu. For other images, we provide urls either to zenodo.org, where we have deposited additional images, or links where other collections have made these images available. In cases where colleagues have generously provided images of primary types that were uploaded by the present authors, the contributor is listed in the comment section at zenodo.org.

Character annotations

atc acetabular carina (Figure 62)

ats postacetabular sulcus (Figure 62)

axu axillula (Figures 5, 7–8, 23, 25, 27, 34, 36, 51, 87, 101, 109, 113)

eps episternal foveae (Figure 64)

lpc lateral propodeal carina (Figure 65)

lpS1 lateral pit on S1 (Figures 16, 18)

lpT1 lateral pit on T1 (Figures 15, 23, 25, 27, 31, 34, 37, 80, 87, 104, 108, 113)

mc mesopleural carina (Figures 62, 75–76, 78)

mes mesopleural epicoxal sulcus (Figure 62)

mtpl metapleuron (Figures 23, 25)

oc occipital carina (Figure 60)

ps papillary sensilla (Figure 39, 61, 116)

s seta (Figures 9, 103, 109)

sc sublateral carina on T1 (Figures 15, 104, 108)

sgs subgenual spines (Figures 21, 28, 33, 38, 46, 66, 79, 111, 112, 115)

spf sulcus of propodeal foramen (Figures 63, 65)

T1 metasomal tergite 1 (Figure 109)

vplc ventral mesopleural carina (Figure 62)

Quarantine rearing

To assess intraspecific variability, we examined G. aetherium that were reared from multiple pentatomid species during host specificity testing. Bagrada hilaris, Thyanta custator (Fab.), Holcostethus abbreviatus Uhler, Banasa sordida (Uhler) and Euschistus conspersus Uhler were collected in north-central California (Monterey, Alameda, Solano or Yolo counties) and maintained in laboratory cultures at the USDA-ARS in Albany, CA, under 28–30 °C, 30–40% RH and 16L:8D photoperiod. A laboratory colony of G. aetherium was maintained in the USDA-ARS quarantine facility in Albany, California, under 22–27 °C, 40–60% RH and 14L:10D, and host specificity tests were conducted in quarantine under the same conditions. Tests followed a no-choice design, whereby individual parasitoids were exposed to one species of pentatomid egg in glass vials. Clusters of 10–15 fresh pentatomid eggs (<24 h old) were glued onto strips of card stock (20 × 60 mm) using Elmer’s Glue-All (Elmer’s Products Inc., Westerville, OH) and placed in glass vials (25 mm diameter × 95mm high), and one 24- to 48-hour-old, mated female parasitoid was then released into each vial and removed after 24 hours. At least one vial containing B. hilaris eggs was also exposed to parasitoids, when possible, to compare the suitability of non-target pentatomids and B. hilaris to the parasitoids. Eggs were then monitored, and numbers of parasitized eggs and emerging pentatomids and parasitoids were recorded. Unhatched eggs were then dissected after ~30 days to record numbers of parasitoid larvae that failed to complete development.

Results

Molecular systematics

We used multiple genetic loci and extensive taxon sampling within Platygastroidea to infer the placement of Gryon aetherium. The concatenated alignment consisted of 194 taxa, 2,706 sites (base pairs and gaps), and 4.3% missing data. Eighty-one (41%) of the 194 taxa were determined as Gryon. Three independent phylogenetic analyses were performed on the alignment that differed by the type of branch support metric (ultrafast bootstrap, non-parametric bootstrap) or tree search strategy (maximum-likelihood, parsimony) employed (Figures 13). In all analyses, several clades were recovered that corroborate the results of prior phylogenetic studies on Scelionidae (Taekul et al. 2014; Chen et al. 2021): (1) the basal position of Neoscelio Dodd (100% UFBS/NPBS); (2) the polyphyly of the subfamily Scelioninae; (3) the monophyly of the tribe Scelionini (65% UFBS, 33% NPBS); (4) the monophyly of Teleasinae (>95% UFBS/NPBS); and (5) the monophyly of Telenominae sensu Taekul et al. (2014) (100% UFBS/NPBS).

The taxa initially determined as belonging to Gryon were recovered as a polyphyletic assemblage composed of two clades. Clade A, with 35 taxa, forms a maximally supported (99–100% support) terminal cluster of species that is sister to a weakly supported (76% UFBS, 17% NPBS) clade of spider-egg parasitoids (Idris Förster, Ceratobaeus Ashmead) (Figure 2). We recognize the taxa in clade A as Hadronotus, which we remove from synonymy with Gryon. Clade B is composed of 51 taxa and forms a maximally supported (99–100% support) group sister to Dyscritobaeus Perkins (97% UFBS, 92% NPBS). Within this clade, the three specimens of G. aetherium sp. n. clustered together at maximum support (100%), as a clade basal to Gryon specimens from California (USA), Myanmar, and South Africa (Figure 3).

Figure 1. 

Best tree from the multi-gene, maximum likelihood phylogenetic analysis of Scelionidae conducted in IQ-TREE. Branch support values were generated from 10,000 ultrafast bootstrap replicates and are indicated above branches. The positions of Hadronotus (Clade A), Gryon (Clade B), and Dyscritobaeus (Clade B) are indicated in green, blue, and red, respectively.

Figure 2. 

Position and phylogenetic relationships of Hadronotus relative to other Scelionidae based on the topology depicted in Figure 1. Colored boxes above branches correspond to the level of support obtained for that branch based on the support metric. Branches annotated with a single box received equal levels of support in all analyses. The scale bar indicates the expected number of substitutions per site.

Figure 3. 

Position and phylogenetic relationships of Gryon relative to other Scelionidae based on the topology depicted in Figure 1. Colored boxes above branches correspond to the level of support obtained for that branch based on the support metric. Branches annotated with a single box received equal levels of support in all analyses. The scale bar indicates the expected number of substitutions per site.

COI barcoding

Sequencing efforts generated 124 new COI barcodes. Annotation of COI amino acids demonstrated that at least four, possibly six, indel phenotypes were present in the scelionid dataset (Table 4, Suppl. material 2). All scelionids analyzed displayed a three amino acid deletion in loop 3, with the single exception of Platyscelidris fossorius Johnson & Musetti, which contained a two amino acid deletion in loop 3 (Table 4). The simplest phenotype (present in 43 genera) has a three amino acid deletion in loop 3 with no other detected deletions. This phenotype is present in Gryon and Maruzza (Table 4). The dataset contained eight Breviscelio Sundholm (=Gryon) barcodes, two of which spanned the entirety of the annotated Agrypnus murinus sequence. The longest two Breviscelio sequences had an additional single amino acid deletion present in loop 1 that was not detected in any other of the analyzed genera (Table 4). Another group of COI phenotypes contained additional amino acid deletions in loop 4. The genera Acanthoscelio Ashmead, Baryconus Förster, Gryonoides Dodd, Teleasinae gen. sp., and Trimorus Förster displayed single amino acid deletions in loop 4. Gryonoides sp. (OSUC 627839) had three amino acids deleted from loop 4, while the other two available Gryonoides COI sequences (data not shown in Suppl. material 2) contained only one deletion. A group of 13 genera, including Hadronotus, had a two amino acid deletion present in loop 4 (Table 4).

Table 4.

COI amino acid phenotypes of Scelionidae. Taxa are listed and colored according to phenotype. Gryon and Hadronotus are highlighted in blue.

Genus No. Seq. Helix 1 Loop 1 Helix 2 Loop 2 Helix 3 Loop 3 Helix 4 Loop 4 Helix 5 Loop 5 Helix 6
Acolomorpha 1 No No 3 AA deletion No No No No No
Amblyscelio 1 No No 3 AA deletion No No No No No
Anteromorpha 1 No 3 AA deletion No No No No No
Apteroscelio 1 No No 3 AA deletion No No No No No
Calliscelio 1 No No No No 3 AA deletion No No No No No
Calotelea 2 No No 3 AA deletion No No No No No
Ceratobaeus 1 No No 3 AA deletion No No No No No
Cremastobaeus 2 No No No No 3 AA deletion No No No No No
Dicroscelio 1 No No No No 3 AA deletion No No No No No
Duta 1 No 3 AA deletion No No No No No
Dyscritobaeus 2 No No 3 AA deletion No No No No No
Elgonia 1 No 3 AA deletion No No No No No
Embidobia 1 No 3 AA deletion No No No No No
Fusicornia 1 No No No No 3 AA deletion No No No No No
Gryon 157 No No No No No 3 AA deletion No No No No No
Heptascelio 1 No No 3 AA deletion No No No No No
Idris 3 No No 3 AA deletion No No No No No
Leptoteleia 1 No No 3 AA deletion No No No No No
Macroteleia 3 No No 3 AA deletion No No No No No
Mantibaria 1 No No 3 AA deletion No No No No No
Maruzza 1 No No No 3 AA deletion No No No No No
Masnerella 1 No No 3 AA deletion No No No No No
Neoscelio 1 No No 3 AA deletion No No No No No
Odontacolus 1 No No 3 AA deletion No No No No No
Oreiscelio 1 No No 3 AA deletion No No No No No
Oxyscelio 1 No No 3 AA deletion No No No No No
Oxyteleia 1 No No 3 AA deletion No No No No No
Parascelio 1 No No 3 AA deletion No No No No No
Paratelenomus 1 No No 3 AA deletion No No No No No
Platyscelio 1 No No 3 AA deletion No No No No No
Probaryconus 2 No No 3 AA deletion No No No No No
Pseudanteris 1 No No 3 AA deletion No No No No No
Pseudoheptascelio 1 No No 3 AA deletion No No No No No
Psilanteris 3 No No 3 AA deletion No No No No No
Psix 2 No No 3 AA deletion No No No No No
Romilius 2 No No No No 3 AA deletion No No No No No
Scelio 4 No No 3 AA deletion No No No No No
Shreemana 1 No 3 AA deletion No No No No No
Spiniteleia 1 No No No No 3 AA deletion No No No No No
Synoditella 1 No No 3 AA deletion No No No No No
Tiphodytes 2 No No 3 AA deletion No No No No No
Trichoteleia 2 No No No No No 3 AA deletion No No No No No
Trissoscelio 1 No No 3 AA deletion No No No No No
Triteleia 2 No No 3 AA deletion No No No No No
(Gryon) Breviscelio 8 No 1 AA deletion No No No 3 AA deletion No No No No No
Acanthoscelio 1 No No 3 AA deletion No 1 AA deletion No No No
Baryconus 1 No No No No 3 AA deletion No 1 AA deletion No No No
Gryonoides 1 No No No No 3 AA deletion No 3 AA deletion* No No No
Teleasinae gen. sp. 1 No 3 AA deletion No 1 AA deletion No No No
Trimorus 1 No No 3 AA deletion No 1 AA deletion No No No
Anteris 1 No 3 AA deletion No 2 AA deletion No No No
Axea 1 No No 3 AA deletion No 2 AA deletion No No No
Dichoteleas 1 No No 3 AA deletion No 2 AA deletion No No No
Eumicrosoma 1 No No No No No 3 AA deletion No 2 AA deletion No No
Hadronotus 169 No No No No No 3 AA deletion No 2 AA deletion No No No
Mallateleia 1 No 3 AA deletion No 2 AA deletion No No No
Paridris 5 No No 3 AA deletion No 2 AA deletion No No No
Phanuromyia 1 No No 3 AA deletion No 2 AA deletion No No No
Platyscelidris 1 No No 2 AA deletion** No 2 AA deletion No No No
Telenomus 43 No No No No No 3 AA deletion No 2 AA deletion No No No
Thoron 2 No No 3 AA deletion No 2 AA deletion No No No
Thoronella 1 No No 3 AA deletion No 2 AA deletion No No No
Trissolcus 22 No No No No No 3 AA deletion No 2 AA deletion No No No

COI barcoding of G. aetherium from Mexico, California, and the quarantined colony collected from Pakistan revealed two haplotypes, differing by two synonymous substitutions. One of the haplotypes is a 100% match to two specimens, previously determined as G. myrmecophilum from Coahuila, Mexico (MK720831 and MK720832). These specimens (FSCA 00090442, FSCA 00090443) were misidentified and are G. aetherium. BOLD queries of G. aetherium barcodes yielded greater than 99% matches to 41 additional public sequences in BIN BOLD:ACF7890. The sequence hits were from Pakistan, Egypt, and South Africa and are identified as Scelioninae. Examination of the three images associated with BIN BOLD:ACF7890 revealed that they are consistent with G. aetherium. These additional sequences suggest several more COI haplotypes of G. aetherium, all with about 99% sequence similarity to each other. Based on the overall sequence similarity, specimen images, and specimen locality data we consider that BIN BOLD:ACF7890 corresponds to G. aetherium, suggesting that the species has a wide distribution. The next nearest cluster of sequences to G. aetherium in BOLD are private and identified only as Platygastridae from Israel and Lebanon.

Maximum-likelihood tree searches of the scelionid COI barcode dataset recovered a bootstrap consensus tree of log-likelihood -39550.451 (Figure 4). The tree topology contains 89 nodes with strong support (>95% UFBS), with most strongly supported nodes corresponding to terminal clusters with some interesting exceptions (Figure 4). A Gryon aetherium cluster was recovered with 100% support. This terminal cluster is nested within a larger group of sequences with marginal support (92% UFBS) identified as Gryon or predicted to be Gryon from our datamining procedure. The large Gryon clade was recovered as sister (with very weak support) to a strongly supported (100% UFBS) clade comprising Telenomus Haliday, Phanuromyia Dodd, Trissolcus, Gryonoides, and two Gryon. Hadronotus sequences, and those predicted to be Hadronotus from our datamining procedure, were more variably placed in the topology. One clade of Hadronotus was recovered as sister to Fusicornia Risbec with weak support. Internal to this node, support becomes stronger (88% UFBS and 98% UFBS) (Suppl. material 3). The remaining Hadronotus fell into a weakly supported clade (54% UFBS) that included Idris, Ceratobaeus, Odontacolus Kieffer and Thoronella Masner (Suppl. material 3).

Figure 4. 

Phylogenetic relationships of Scelionidae based on a maximum likelihood analysis of 479 COI sequences. Branches in blue and red indicate Hadronotus and Gryon, respectively. Terminals belonging to G. aetherium are shown to the right of the phylogenetic tree. Terminals highlighted in yellow correspond to adventive G. aetherium specimens collected in Mexico and California. Scale bars indicate the expected number of substitutions per site.

Character discussion

Axillula

The scutellar-axillar complex is a rich source of characters that have yet to be fully exploited in the taxonomy of Platygastroidea. Striation within the area delimited by the axillar, transaxillar, and axillular carinae can take a variety of forms (Figures 5–8). Figure 6 illustrates this area in Duta Nixon where the foveae on the posterior and ventral portions are orthogonal to each other and the anterior portion has a series of flanges. In Gryon, the axillula is striate with the striae parallel or nearly so. The striae are oblique relative to the longitudinal axis of the body and oriented from anterodorsal to posteroventral. This is generally a reliable character for Gryon, albeit one that is sometimes obscured by the base of the forewing, and we know of two cases in which the striae are largely absent or irregular (see comments sections for G. moczari and G. paradigma). In Hadronotus, the foveae within the axillula can be ovoid or circular (Figures 7–8).

Figures 5–8. 

Scutellar-axillar complex, lateral view 5 Gryon aetherium (USNMENT01109155) 6 Duta (USNMENT01109621_2) 7 Hadronotus hogenakalensis (DPI_FSCA 00008722) 8 Hadronotus carinatifrons (USNMENT01335649).

Metapleuron

The metapleuron in Gryon has 1–3 setae in the anterodorsal corner and occasionally a single seta in the dorsal metapleural area, but it is otherwise glabrous (Figure 9). In Hadronotus, setation is typically present in the foveae of the paracoxal sulcus, the metapleural epicoxal sulcus, and the posterior or posterodorsal portion of the sclerite (Figures 10–12). In many cases, the metapleuron is divided antero-posteriorly by a carina or a change in setation or sculpture (Figures 11–13). For example, in H. anserculus (Mineo), a line of sparse setae separates the posterior, smooth portion from the anterior, more rugose portion (Figure 13). In a few cases, such as H. canus (Mineo), the entire metapleuron is setose (Figure 14).

Figures 9–14. 

Mesosoma, lateral view 9 Gryon aetherium (FSCA 00094874) 10 Hadronotus hogenakalensis (DPI_FSCA 00008722) 11 Hadronotus ater (FSCA 00094730) 12 Hadronotus pennsylvanicus (FSCA 00091081) 13 Hadronotus anserculus, holotype female 14 Hadronotus canus, holotype female.

Metasomal tergite 1

In Gryon, the line of foveae along the anterior margin of T1 terminates laterally at a carina (Figure 15, sc) that is more robust that any adjacent striation; directly lateral to this carina is a pit (Figure 15, lpT1). The foveae along the anterior margin are uniform in size and distinctly smaller than the lateral pit. In Hadronotus, the foveae along anterior T1 are largest at the midline and decrease in size laterally (Figures 17, 19). In most cases, there is no suggestion of a pronounced carina or lateral pit, but in H. bicolor Ashmead, for example, the penultimate fovea on lateral T1 is larger than the fovea directly mesad (Figure 18). However, this does not approximate the form found in Gryon. The pattern along anterior S1 in Gryon aetherium is essentially identical to that on T1, with a line of uniform, small foveae terminating at a carina, then a large pit (Figure 16, lpS1). However, we do not yet draw any conclusions about S1 in Gryon because this sclerite is not easily visible in most specimens and we have dissected and analyzed a relatively small number of species. The presence of a large lateral pit on S1 is more common in Scelionidae and it appears in both Hadronotus (Figures 18, 20) and Teleasinae.

Figures 15–20. 

Metasoma 15 Gryon aetherium (FSCA 00094873), dorsolateral view 16 Gryon aetherium (FSCA 00094873) ventrolateral view 17 Hadronotus bicolor (FSCA 00091193), dorsolateral view 18 Hadronotus bicolor (FSCA 00091193), lateral view 19 Hadronotus carinatifrons (USNMENT01335649), dorsolateral view 20 Hadronotus carinatifrons, ventrolateral view.

Diagnostic summary

1 Clypeus not projecting ventrally; antennal scrobe with transverse sculpture; metapleuron divided dorsoventrally by a change in sculpture or setation; metapleuron usually setose in posterior portion; hind tibia without subgenual spines; foveae along anterior T1 decreasing in size laterally, not bordered laterally by a carina or pit Hadronotus Förster
Clypeus projecting ventrally, usually with sharp lateral corners; antennal scrobe without transverse sculpture; metapleuron undivided dorsoventrally by a change in sculpture or setation; metapleuron with 1–3 setae in anterodorsal corner, sometimes with a single seta in dorsal metapleural area, otherwise glabrous; hind tibia with subgenual spines; foveae along anterior T1 roughly equal in size, ending in a sublateral carina or pit Gryon Haliday

Images

Links to images of primary or secondary types are provided in the treatment for each species. Table 5 includes these links for primary types of genera and summarizes the rearrangement of generic synonyms in Gryon and Hadronotus. Table 6 lists the specimens in the molecular analyses that have been photographed, which includes all specimens of Gryon and most Hadronotus, to further illustrate the characters associated with these genera and some of the diversity of their constituent species. Images of Maruzza japonica, also from the molecular analysis, are presented in Figures 96–99.

Table 5.

A summary of the genera treated as junior synonyms of Gryon and Hadronotus with links to available images of primary types.

Genus Date Type species Images of Type Specimen
Gryon Haliday 1833 Gryon misellum Haliday https://zenodo.org/record/4498847#.YBrybXlOlaQ
Acolus Förster 1856 Acolus opacus Thomson
Plastogryon Kieffer 1908 Plastogryon foersteri Kieffer
Psilacolus Kieffer 1908 Acolus xanthogaster Ashmead USNMENT00989056
Holacolus Kieffer 1912 Acolus opacus Thomson
Plesiobaeus Kieffer 1913 Plesiobaeus hospes Kieffer
Hadronotellus Kieffer 1917 Hadronotellus pedester Kieffer ZMUC 0002
Heterogryon Kieffer 1926 Plastogryon sagax Kieffer
Synteleia Fouts 1927 Synteleia coracina Fouts USNMENT00989057
Eremioscelio Priesner 1951 Eremioscelio cydnoides Priesner USNMENT01059665
Hungarogryon Szabó 1966 Hungarogryon moczari Szabó Hym.Typ.No. 9634, Mus.Budapest
Masneria Szabó 1966 Hadronotus lymantriae Masner
Pannongryon Szabó 1966 Pannongryon szelenyii Szabó https://zenodo.org/record/4521320#.YCGzRnlOlaQ
Sundholmia Szabó 1966 Sundholmia nitens Szabó
Breviscelio Sundholm 1970 Breviscelio crenatus Sundholm https://www.flickr.com/photos/127240649@N08/50616991701/in/photolist-2k7Rjat-2k7Mx3Y-2k7Rj9M-2k7RTii-2k7Rja8/
Exon Masner 1980 Exon californicum Masner
Hadronotus Förster 1856 Hadronotus exculptus Förster https://zenodo.org/record/4504407#.YCGDd3lOlaQ
Muscidea Motschoulsky 1863 Muscidea pubescens Motschoulsky https://zenodo.org/record/4924954#.YOSoF0lKhaQ
Hadronotoides Dodd 1913 Hadronotus pentatomus Dodd SAMA DB 32-001664
Platyteleia Dodd 1913 Platyteleia latipennis Dodd SAMA I.1396
Telenomoides Dodd 1913 Telenomoides flavipes Dodd https://zenodo.org/record/5188097#.YRUi0MpKhaQ
Notilena Brèthes 1913 Notilena gallardoi Brèthes
Austroscelio Dodd 1914 Sparasion nigricoxa Dodd SAMA DB 32-001667
Hadrophanurus Kieffer 1926 Telenomus pennsylvanicus Ashmead https://zenodo.org/record/4520251#.YCGBzXlOlaQ
Table 6.

List of specimens from the molecular analysis that have been photographed. It includes all specimens of Gryon and representatives for each species of Hadronotus.

Taxon CUID Link to images
Gryon sp. USNMENT01335610 https://zenodo.org/record/4558207#.YN974ElKhaQ
USNMENT01335583 https://zenodo.org/record/4558210#.YN98DklKhaQ
SAM-HYM-P093661 https://zenodo.org/record/4558205#.YN98NElKhaQ
SAM-HYM-P093276 https://zenodo.org/record/4558203#.YN98PUlKhaQ
Gryon myrmecophilum USNMENT01335734 https://zenodo.org/record/4558198#.YN98W0lKhaQ
USNMENT01335823 https://zenodo.org/record/4558187#.YN98eUlKhaQ
USNMENT01335654 https://zenodo.org/record/4558181#.YN98jUlKhaQ
USNMENT01335597 https://zenodo.org/record/4558177#.YN98n0lKhaQ
USNMENT01223867 https://zenodo.org/record/4558173#.YN98sUlKhaQ
USNMENT01223767 https://zenodo.org/record/4558165#.YN98xUlKhaQ
USNMENT01223642 https://zenodo.org/record/4558159#.YN985ElKhaQ
USNMENT00979274 https://zenodo.org/record/4558153#.YN98-ElKhaQ
USNMENT00979258 https://zenodo.org/record/4558145#.YN99DElKhaQ
SAM-HYM-P093315 https://zenodo.org/record/4558143#.YN99IklKhaQ
SAM-HYM-P093303 https://zenodo.org/record/4558141#.YN99N0lKhaQ
FSCA 00094787 https://zenodo.org/record/4558138#.YN99SklKhaQ
FSCA 00094784 https://zenodo.org/record/4558120#.YN99e0lKhaQ
FSCA 00091861 https://zenodo.org/record/4558116#.YN99jklKhaQ
FSCA 00091137 https://zenodo.org/record/4558108#.YN99zUlKhaQ
FSCA 00091102 https://zenodo.org/record/4558101#.YN996ElKhaQ
FSCA 00091067 https://zenodo.org/record/4558093#.YN9-A0lKhaQ
FSCA 00091048 https://zenodo.org/record/4558089#.YN9-F0lKhaQ
FSCA 00091024 https://zenodo.org/record/4558084#.YN9-bUlKhaQ
FSCA 00090560 https://zenodo.org/record/4558078#.YN9-dElKhaQ
FSCA 00090445 https://zenodo.org/record/4558072#.YN9-fElKhaQ
FSCA 00033220 https://zenodo.org/record/4558056#.YN9-VElKhaQ
FSCA 00000032 https://zenodo.org/record/4558051#.YN9-hklKhaQ
FSCA 00000008 https://zenodo.org/record/4558039#.YN9-mElKhaQ
Gryon sp. USNMENT01335826 https://zenodo.org/record/4558015#.YN9-rElKhaQ
USNMENT01335596 https://zenodo.org/record/4558011#.YN9-wklKhaQ
USNMENT01223954 https://zenodo.org/record/4557989#.YN9-1UlKhaQ
SAM-HYM-P093637 https://zenodo.org/record/4557969#.YN9-50lKhaQ
SAM-HYM-P093263 https://zenodo.org/record/4557961#.YN9_DUlKhaQ
FSCA 00090886 https://zenodo.org/record/4557955#.YN9_H0lKhaQ
USNMENT01335595 https://zenodo.org/record/4557944#.YN9_PElKhaQ
SAM-HYM-P093641 https://zenodo.org/record/4557938#.YN9_UklKhaQ
USNMENT01335824 https://zenodo.org/record/4557928#.YN9_ZUlKhaQ
FSCA 00033267 https://zenodo.org/record/4557917#.YN9_eElKhaQ
USNMENT01335812 https://zenodo.org/record/4557913#.YN9_mUlKhaQ
USNMENT01335625 https://zenodo.org/record/4557902#.YN9_t0lKhaQ
FSCA 00090543 https://zenodo.org/record/4557899#.YN9_yklKhaQ
USNMENT01223795 https://zenodo.org/record/4557892#.YN9_30lKhaQ
USNMENT01223656 https://zenodo.org/record/4557832#.YN-AxUlKhaQ
FSCA 00090887 https://zenodo.org/record/4557820#.YN-A10lKhaQ
DPI_FSCA 00009833 https://zenodo.org/record/4557799#.YN-A4UlKhaQ
Gryon crenatum SAM-HYM-P093675 https://zenodo.org/record/4557773#.YN-A9UlKhaQ
SAM-HYM-P093658 https://zenodo.org/record/4557739#.YN-BWUlKhaQ
SAM-HYM-P093308 https://zenodo.org/record/4557727#.YN-BaklKhaQ
Hadronotus sp. FSCA 00094689 https://zenodo.org/record/5055893#.YORbJjOSmM8
SAM-HYM-P093286A https://zenodo.org/record/5055622#.YORbezOSmM8
Hadronotus obesus DPI_FSCA 00009874 https://zenodo.org/record/5055577#.YORbqTOSmM8
Hadronotus sp. SAM-HYM-P093613 https://zenodo.org/record/5055533#.YORb2TOSmM8
Hadronotus pennsylvanicus FSCA 00033171 https://zenodo.org/record/5055465#.YORb_DOSmM8
Hadronotus sp. FSCA 00094681 https://zenodo.org/record/5047752#.YORcIzOSmM8
Hadronotus radicularis FSCA 00091862 https://zenodo.org/record/5047719#.YORcQzOSmM8
Hadronotus sp. FSCA 00094687 https://zenodo.org/record/5080975#.YOYIWOhKg2w
FSCA 00094692 https://zenodo.org/record/5080835#.YOYKsOhKg2w
Hadronotus pennsylvanicus FSCA 00094782 https://zenodo.org/record/5081043#.YOYODOhKg2w
Hadronotus sp. SAM-HYM-P093638 https://zenodo.org/record/5086004#.YOhpzzOSmM8
USNMENT01223737 https://zenodo.org/record/5085986#.YOhqNTOSmM8
SAM-HYM-P093243 https://zenodo.org/record/5086109#.YOhrgTOSmM8
SAM-HYM-P093622 https://zenodo.org/record/5086454#.YOh3-ElKhaQ
SAM-HYM-P093679 https://zenodo.org/record/5086600#.YOh6JElKhaQ
Hadronotus anasae USNMENT01335790 https://zenodo.org/record/5093270#.YOyFIklKhaQ
Hadronotus atrum FSCA 00094730 https://zenodo.org/record/5093412#.YOyFEUlKhaQ
Hadronotus carinatifrons USNMENT01335649 https://zenodo.org/record/5093598#.YOyE8UlKhaQ
Hadronotus bicolor FSCA 00091193 https://zenodo.org/record/5093580#.YOyFAUlKhaQ
Hadronotus leptocorisae FSCA 00090459 https://zenodo.org/record/5093611#.YOyE3UlKhaQ
Hadronotus rugiceps FSCA 00094731 https://zenodo.org/record/5093642#.YOyH_0lKhaQ

Gryon Haliday

Gryon Haliday, 1833: 271 (original description. Type species: Gryon misellum Haliday, by monotypy, keyed); Walker, 1836: 343 (description); Westwood, 1840: 77 (description); Blanchard, 1840: 289 (junior synonym of Teleas Latreille); Brullé, 1846: 619 (description); Förster, 1856: 101, 105 (diagnosis, keyed); Marshall, 1873: 16 (catalog of species of Britain); Walker, 1874: 9 (keyed); Howard, 1886: 172 (keyed); Cresson, 1887: 84 (keyed); Ashmead, 1893: 181, 205 (description, keyed, key to species of U.S. and Canada); Dalla Torre, 1898: 502 (catalog of species); Ashmead, 1900: 327 (list of species of West Indies); Ashmead, 1903: 90 (keyed); Kieffer, 1908: 188, 189 (description, keyed); Brues, 1908: 19, 25, 49 (diagnosis, keyed, list of species); Kieffer, 1910: 91, 92 (description, list of species, keyed); Kieffer, 1912: 109 (description); Kieffer, 1913: 212 (description, taxonomic status, key to species of Europe and Algeria); Dodd, 1914a: 75 (keyed); Kieffer, 1926: 173, 260 (description, keyed, key to species); Morley, 1929: 54 (catalog of species of Britain); Dodd, 1930: 42 (keyed); Nixon, 1936: 115 (taxonomic status, position); Maneval, 1940: 112, 113 (keyed); Fouts, 1948: 92 (keyed); Muesebeck & Walkley, 1951: 356 (citation of type species); Masner, 1961: 158 (synonymy, systematic position, description); Kozlov, 1963a: 354, 357 (description, key to species of USSR, keyed); Kozlov, 1963b: 661, 667 (description, keyed, key to species); Szabó, 1966: 422 (keyed); De Santis, 1967: 225 (catalog of species of Argentina); Safavi, 1968: 418 (parasitized eggs of Scutelleridae keyed); Hellén, 1971: 5, 21 (description, keyed); Kozlov, 1971: 38 (keyed); Kozlov, 1972: 654 (key to new species described); Alayo Dalmau, 1973: 99 (catalog of species of Cuba); Simons, Reardon & Ticehurst, 1974: 15 (keyed); Viggiani & Mineo, 1974: 160, 161 (keyed); Mani & Mukerjee, 1976: 497 (key to new species described); Masner, 1976: 7, 57 (description, synonymy, keyed); Fergusson, 1978: 118 (checklist of species of Britain); Kozlov, 1978: 619 (description, key to species of European USSR); Mineo, 1979b: 91 (diagnosis, key to species parasitizing Aelia and Eurygaster (Hemiptera: Pentatomidae)); Muesebeck, 1979: 1157 (catalog of species of U.S. and Canada); Masner, 1980: 12, 13 (keyed); Mineo, 1980b: 216 (diagnoses and keys to species of insulare and pubescens species groups); De Santis, 1980: 311 (catalog of species of Brazil); Mineo, 1981a: 119 (description and key to species of the muscaeformis species group); Mani & Sharma, 1982: 152, 191 (description, keyed); Mineo & Villa, 1982b: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 134 (taxonomic value of structures on the posterior surface of the head); Sharma, 1982: 336 (key to species of India); Masner, 1983: 126, 127 (description, morphology, division into species groups, key to species of North America, keyed); Mineo, 1983b: 285 (description and key to species of the pubescens species group); Mineo, 1983c: 546, 551 (descriptions and keys to species of the insulare and oculatum species groups); Mineo, 1983a: 12 (description and key to species of the charon species group); Galloway & Austin, 1984: 6, 78 (diagnosis, synonymy, list of species described from Australia, keyed); Mineo & Caleca, 1987b: 41 (diagnoses of the misellum, artum, austrafricanum and hospes species groups; key to species of the artum group); Kozlov & Kononova, 1989: 78 (key to species of the USSR); Kozlov & Kononova, 1990: 96, 265, 266 (description, division into species groups, key to species of Palearctic, keyed); Caleca, 1990a: 116 (description, key to species of pentatomum group); Mineo, 1990a: 171, 174, 180, 182 (description of artum, muscaeforme, myrmecophilum, oculatum, pubescens groups); Mineo, 1990b: 49, 52 (description of hiberus, leptocorisae species groups); Mineo, 1990c: 90 (description of letus group, key to species of letus group); Mineo, 1991: 1, 2, 7, 9, 10, 12 (description of aculum, acuteangulatum, aureum, cydnoide, hungaricum, introversum species groups, synonymy, key to species of hungaricum group); Johnson, 1992: 374 (cataloged, catalog of world species); Mineo & Caleca, 1994: 114, 116, 121, 127 (designation of hirsuticolum group, fulviventre subgroup of muscaeforme group, subfasciatum group, lymantriae group, key to species of lymantriae group); Kononova, 1995: 62, 81 (keyed, diagnosis, key to species of Russian Far East); Austin & Field, 1997: 36, 68 (structure of ovipositor system, discussion of phylogenetic relationships); Lê, 2000: 32, 95 (keyed, description, key to species of Vietnam); Kononova & Petrov, 2001: 1468 (description); Kononova & Petrov, 2002: 53 (key to species of Palearctic); Loiácono & Margaría, 2002: 557 (catalog of Brazilian species); Rajmohana K., 2006: 115, 123 (description, keyed); Fabritius & Popovici, 2007: 11, 13, 14, 26, 29, 63 (description, key to Romanian species, key to species related to Gryon longiabdominalis and buhli, keyed); Kononova & Kozlov, 2008: 25, 321, 322 (description, keyed, key to species of Palearctic region); Popovici & Johnson, 2012: 382 (description of internal genitalia); Rajmohana, 2014: 8, 33 (description, keyed); Talamas & Buffington, 2015: 21 (fossil in Dominican amber). Comments. The lectotype and paralectotype specimens of G. misellum Haliday are in excellent condition considering their age (~190 years old) and these specimens display all the diagnostic characters that we associate with the genus (Figures 2125).

Acolus Förster, 1856: 100, 102 (original description. Type species: Acolus opacus Thomson, designated by Ashmead (1903), keyed. Synonymized by Masner (1961)); Thomson, 1859: 417, 422 (description, keyed); Walker, 1874: 9 (keyed); Howard, 1886: 172 (keyed); Cresson, 1887: 83, 313 (keyed, catalog of species of U.S. and Canada); Ashmead, 1893: 167, 168, 174 (description, keyed); Dalla Torre, 1898: 510 (catalog of species); Ashmead, 1903: 88, 89 (keyed); Kieffer, 1908: 179, 180 (description, key to species, keyed); Brues, 1908: 14, 15, 16, 47 (diagnosis, keyed, list of species); Kieffer, 1910: 100, 101 (description, list of species, keyed); Kieffer, 1912: 89, 92 (description, key to species of Europe and Algeria); Kieffer, 1912: 55 (key to species of Seychelles); Dodd, 1914a: 58, 70 (key to species of Australia, keyed); Brues, 1916: 542 (keyed); Kieffer, 1926: 133, 156 (description, keyed, key to species); Jansson, 1939: 173 (keyed); Maneval, 1940: 111 (keyed); Muesebeck & Walkley, 1956: 324 (citation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday).

Plastogryon Kieffer, 1908: 119, 141 (original description. Type: Plastogryon foersteri Kieffer, designated by Brues (1908)); Brues, 1908: 51 (diagnosis, list of species, type designation); Kieffer, 1910: 65, 81 (description, list of species, keyed); Dodd, 1913a: 131 (keyed); Kieffer, 1913: 230, 245 (description, key to species of Europe and Algeria); Dodd, 1915: 24 (key to species of Australia); Dodd, 1915: 24 (key to species of Australia); Kieffer, 1926: 270, 446 (description, keyed, key to subgenera, key to species); Jansson, 1939: 172 (keyed); Muesebeck & Walkley, 1956: 385 (citation of type species); Masner 1961: 158 (junior synonym of Gryon Haliday).

Psilacolus Kieffer, 1908: 179, 180 (original description. Type species: Acolus xanthogaster Ashmead, designated by Kieffer (1926)); Brues, 1908: 47 (diagnosis, list of species); Kieffer, 1910: 100, 101 (description, list of species, keyed); Kieffer, 1912: 88 (description); Dodd, 1914a: 59 (keyed); Kieffer, 1926: 132, 151 (description, keyed, key to species); Muesebeck & Walkley, 1956: 393 (citation of type species); Muesebeck & Masner, 1967: 299 (junior synonym of Gryon Haliday).

Holacolus Kieffer, 1912: 89, 106 (original description. Type species: Acolus opacus Thomson, designated by Muesebeck & Walkley (1956). Key to species of Europe and Algeria); Kieffer, 1926: 133, 169 (description, keyed, key to species); Jansson, 1939: 173 (keyed); Maneval, 1940: 111 (keyed); Muesebeck & Walkley, 1956: 359 (designation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday).

Plesiobaeus Kieffer syn. rev., 1913: 229, 282 (original description. Type: Plesiobaeus hospes Kieffer, by monotypy); Kieffer, 1926: 271, 556 (description, keyed); Morley, 1929: 54 (catalog of species of Britain); Jansson, 1939: 172 (keyed); Maneval, 1940: 112 (keyed); Muesebeck & Walkley, 1956: 386 (citation of type species); Szabó, 1966: 422 (keyed); Kozlov, 1971: 38 (keyed); Fergusson, 1978: 118 (checklist of species of Britain); Kozlov, 1978: 621 (description); Mineo, 1979a: 248 (junior synonym of Gryon Haliday); Masner, 1980: 13 (keyed); Kozlov & Kononova, 1990: 96, 265, 307 (description, keyed); Fabritius & Popovici, 2007: 11, 34, 63 (description, keyed); Kononova & Kozlov, 2008: 25, 445 (description, keyed, treated as valid genus). Comments.Mineo (1979a) stated that Plesiobaeus hospes seemed to be conspecific with Gryon misellum based on its original description. He also stated that the type was examined but did not provide characters based on this examination to support the generic transfer. Mineo and Caleca (1987b) reported that the species in this group, containing only G. hospes, had a 1-2-2-0 claval formula, which is consistent with some species of Gryon, e.g., G. moczari, whereas no species of Hadronotus known to us has such a claval formula.

Hadronotellus Kieffer, 1917: 341 (original description. Type: Hadronotellus pedester Kieffer, by monotypy and original designation. Synonymized by Kieffer (1926)); Muesebeck & Walkley, 1956: 357 (citation of type species); Szabó, 1966: 421, 422 (description, key to Palearctic species known to the author, keyed); Hellén, 1971: 5, 22 (description, keyed).

Heterogryon Kieffer, 1926: 271, 446, 448 (original description. Type: Plastogryon sagax Kieffer, designated by Muesebeck & Walkley (1956). Proposed as a subgenus of Plastogryon, keyed. Synonymized by Masner (1961)); Muesebeck & Walkley, 1956: 359 (designation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday).

Eremioscelio Priesner syn. rev., 1951: 129 (original description. Type: Eremioscelio cydnoides Priesner, by monotypy and original designation); Muesebeck & Walkley, 1956: 351 (citation of type species); Kozlov, 1963a: 354, 357 (description, keyed); Kozlov, 1963b: 661, 666 (description, keyed); Kozlov, 1971: 38, 49 (synonymy, keyed); Kozlov, 1972: 656 (key to species); Masner, 1976: 59 (description); Kozlov, 1978: 621 (description, key to species of European USSR); Kozlov & Kononova, 1990: 95, 265, 310, 311 (description, key to species of USSR, keyed); Mineo, 1991: 1, 9 (junior synonym of Gryon Haliday, described as cydnoide species group); Johnson, 1992: 372 (cataloged, catalog of world species); Kononova, 1995: 62, 85 (keyed, diagnosis, key to species of Russian Far East); Fabritius & Popovici, 2007: 11, 36, 63 (description, key to Romanian species, keyed); Kononova & Kozlov, 2008: 25, 451 (description, keyed, key to species of Palearctic region, treated as a valid genus). Comments. Images of the holotype specimen of Eremioscelio cydnoides illustrate important diagnostic characters of Gryon: the lateral pit on T1 and the presence of subgenual spines (Figures 31, 33). Examination of additional material revealed that the clypeus is anteriorly projecting with sharp corners (Figure 30) and that the axillula is striate (Figures 32, 34). The transverse, wavy sculpture on the mesoscutum and mesoscutellum of this species is an oddity for the genus (Figures 31–32).

Hungarogryon Szabó syn. n., 1966: 422, 443 (original description. Type: Hungarogryon moczari Szabó, by monotypy and original designation, keyed); Kozlov, 1971: 38 (keyed); Kozlov, 1978: 621 (description); Masner, 1980: 13 (keyed); Kozlov & Kononova, 1990: 96, 265, 320 (description, keyed); Johnson, 1992: 402 (cataloged, catalog of world species); Fabritius & Popovici, 2007: 63 (keyed); Kononova & Kozlov, 2008: 25, 461 (description, keyed). Comments.Gryon moczari (=Hungarogryon moczari) was the sole species in Hungarogryon, and is very small, only slightly longer than 0.5 mm in length. We place this species in Gryon based on the presence of subgenual spines on the hind tibia (Figure 38), a frons without transverse sculpture in the frontal depression (Figure 35), a protruding clypeus with sharp corners (Figure 35), and the lateral pit on T1 (Figure 37). However, in two characters, Gryon moczari differs from the rest of Gryon: the axillula is mostly smooth with crenulae present only along the anterodorsal margin (Figure 36) and the antenna has three clavomeres instead of the usual four (Figure 39). We consider it most likely that these characters are derived within the genus and are related to reduction in body size. The forewing has a fringe of long, delicate setae. The slide-mounted wing illustrated in Figure 40 retains only one of these setae.

Masneria Szabó, 1966: 422, 442 (original description. Type: Hadronotus lymantriae Masner, by monotypy and original designation, keyed. Synonymized by Masner (1976)); Masner, 1976: 57 (junior synonym of Gryon Haliday).

Pannongryon Szabó, 1966: 422, 435 (original description. Type: Pannongryon szelenyii Szabó, by original designation. Key to species known to author, keyed. Synonymized implicitly by Kozlov (1971), explicitly by Masner (1976)); Kozlov, 1971: 47 (junior synonym of Gryon Haliday).

Sundholmia Szabó, 1966: 422, 438 (original description. Type: Sundholmia nitens Szabó, by monotypy and original designation, keyed. Synonymized by Mineo (1980a)); Kozlov, 1971: 38 (keyed); Mineo, 1980a: 200 (junior synonym of Gryon Haliday).

Breviscelio Sundholm syn. n., 1970: 383 (original description. Type: Breviscelio crenatus Sundholm, by monotypy and original designation); Mineo & Villa, 1982b: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 138 (taxonomic value of structures on the posterior surface of the head); Caleca, 1990b: 139 (description); Johnson, 1992: 354 (cataloged, catalog of world species); Caleca, 1992: 52, 53 (key to species, discussion of relationships); Austin & Field, 1997: 39, 68 (structure of ovipositor system, discussion of phylogenetic relationships) Comments. Our treatment of Breviscelio as a junior synonym of Gryon is supported by molecular and morphological evidence. Specimens of Gryon crenatum (=Breviscelio crenatus, the type species of Breviscelio) were retrieved within the Gryon clade in the 4-gene and COI analyses. The striate axillula and the lateral pit on T1 are visible in the holotype specimen (Figure 41). Figures 42–46 illustrate other specimens of Gryon crenatum from South Africa, showing that this species also has the suite of characters used to diagnose Gryon: antennal scrobe without transverse sculpture (Figure 42); head and dorsal mesosoma covered with microsculpture (Figures 42–44); metapleuron mostly glabrous and undivided by change in sculpture or setation (Figure 43), subgenual spines present on the hind tibia (Figure 46). The conspicuous frontal ridge in G. crenatum is associated with an elongation and oblique orientation of the mandibles. This association is known from other platygastroids, including Encyrtoscelio Dodd, Tyrannoscelio Masner, Johnson & Arias-Penna, Acanthoscelio (Scelionidae) and Sparasion Latreille (Sparasionidae) (Figures 47–50) and may be an adaptation for using the mandibles to dig through soil. Gryon crenatum has spines throughout the tibiae and tarsi on all legs and unusual spatulate setae found on the fore tarsus (Figure 45), which may also be adaptations for fossorial behavior.

Exon Masner syn. rev., 1980: 12, 22 (original description. Type: Exon californicum Masner, by original designation, keyed. Synonymized by Mineo (1980b)); Mineo, 1980b: 215 (junior synonym of Gryon Haliday); Kozlov & Kononova, 1990: 95, 265, 308 (description, key to species of USSR, keyed); Kononova & Petrov, 2002: 57 (description, key to species of Palearctic); Fabritius & Popovici, 2007: 11, 41, 63 (description, keyed); Kononova & Kozlov, 2008: 25, 446 (treated as valid genus, description, keyed, key to species of Palearctic region). Comments. Like Eremioscelio, Exon has moved in and out of Gryon since it was first described. Our examination of a paratype specimen indicates that it belongs in Gryon. The antennal scrobe lacks transverse sculpture, the metapleuron is mostly glabrous and undivided, and striation of the axillula is visible (Figures 51–52). Figure 53 illustrates the dorsal metasoma. The quality of the image does not enable us to see the lateral pit on T1, but the uniform size of the foveae along the anterior margin of T1 is apparent, and this supports its placement in Gryon.

Diagnosis

Head with coriaceous microsculpture throughout; mandibles usually bidentate with teeth large and roughly equal in size, sometimes tridentate with medial tooth the smallest; clypeus projecting, typically with pointed corners; ventral frons sometimes with weakly indicated facial striae; central keel present or absent; antennal scrobe convex to concave, without transverse rugae or striation, never delimited by carinae; female antenna with ten flagellomeres (nine in G. paradigma) and four clavomeres (three in G. moczari); mesoscutum and mesoscutellum with coriaceous microsculpture throughout, occasionally with longitudinal striation or microsculpture in the form of transverse waves; epomial carina absent or weakly developed; netrion absent; mesoscutal suprahumeral sulcus absent; mesoscutal humeral sulcus absent or indicated by a smooth furrow; mesoscutum without humeral pit (sensu Chen et al., 2020); axillula obliquely striate; metapleuron with 1–3 setae in anterodorsal corner, sometimes with a single seta in dorsal metapleural area, otherwise glabrous; metapleuron undivided dorsoventrally by a change in sculpture or setation; hind tibia with one or two pairs of subgenual spines; foveae along anterior T1 roughly equal in size, ending in a sublateral carina followed by a lateral pit.

The two most unusual species, as far as diagnostic characters are concerned, are G. moczari and G. paradigma. The former is discussed in the comments section for the synonymy of Hungarogryon. Gryon paradigma is unusual in that the females have eleven antennomeres instead of twelve, the ventrolateral corners of the clypeus are not pointed, and the axillular striae are wavy and irregular (Figures 26–28). This species otherwise complies with the diagnosis above and we consider it to be a derived species of Gryon.

Figure 21. 

Gryon misellum, lectotype male (NMINH_2018_11_02), dorsal view.

Figures 22–23. 

Gryon misellum 22 lectotype male (NMINH_2018_11_02), head, anterolateral view 23 paralectotype female (NMINH_2018_11_03), head, mesosoma, metasoma, dorsolateral view.

Figures 24–25. 

Gryon misellum, paralectotype female (NMINH_2018_11_03) 24 habitus, dorsolateral view 25 mesosoma and T1, dorsolateral view.

Figures 26–28. 

Gryon paradigma (CNC664037) 26 head, anterior view 27 mesosoma and T1, dorsolateral view 28 hind leg, lateral view.

Species of Gryon

Gryon aetherium Talamas, sp. nov.

Figures 5, 9, 15–16, 54–57, 58, 59–66, 67–72.

Description

Color of body: dark brown to black. Color of legs: coxae and femora brown; trochanters, tibiae and tarsi yellow to pale brown.

Color of antenna in female: yellow to pale brown, A9–A12 generally darker than preceding antennomeres.

Head: Number of mandibular teeth: 2. Shape of mandibular teeth: large, teeth roughly equal in size. Shape of clypeus: projecting ventrally, apex flat to convex, with sharp lateral corners. Number of clypeal setae: 6. Epiclypeal carina: absent. Facial striae: present as lines of microsculpture. Central keel: present. Line of setae above interantennal process: absent. Malar striae: present as lines of microsculpture. Genal carina: absent. Hyperoccipital carina: absent. Anterior margin of occipital carina on gena: smooth. Occipital carina: present dorsally and in ventral portion of gena, absent or weakened posterodorsal to compound eye.

Mesosoma: Epomial carina: absent. Sculpture of lateral pronotum: reticulate microsculpture. Netrion sulcus: absent. Mesoscutal suprahumeral sulcus: absent. Mesoscutal humeral sulcus: absent. Sculpture of mesoscutum: reticulate microsculpture.

Sculpture of mesoscutellar disc: reticulate microsculpture. Posterior mesoscutellar sulcus: foveate. Posterior margin of mesoscutellum: extending over metanotum, metascutellum not visible in dorsal view. Posterior margin of metascutellum: slightly convex. Sculpture on posteroventral surface metascutellum: weakly rugulose. Sculpture of metanotal trough: foveate. Length of postmarginal vein in fore wing: about 1.5 times as long as stigmal vein. Length of marginal vein in fore wing: about half as long as stigmal vein. Wing color: hyaline with transverse band of infuscation posterior to marginal vein. Shape of submarginal vein: straight in basal 4/5, with dip proximal to reaching wing margin.

Lateral propodeal carina: continuous across posterior propodeum, forming flange around metasomal depression. Sculpture of metasomal depression: weakly rugulose. Sulcus of the propodeal foramen: foveate dorsally, absent ventrally. Cells or foveae along ventral margin of mesopleural carina: absent. Posterior limit of acetabulum: acetabular carina intersecting with ventral mesopleural carina. Postacetabular sulcus: foveate. Mesopleural epicoxal sulcus: foveate. Episternal foveae: present. Mesopleural carina: absent; present only at ventral apex of femoral depression. Sculpture of anteroventral mesopleuron: reticulate microsculpture. Sculpture of femoral depression: smooth. Prespecular sulcus: foveate. Sculpture of speculum: finely striate. Shape of subalar pit: circular. Mesepimeral sulcus: comprised of transverse foveae, foveae absent or reduced in size posterior to speculum. Sculpture of posterior mesepimeral area: smooth. Paracoxal sulcus: indicated by transverse foveae, extending below metapleural pit but not to ventral margin of metapleuron. Metapleural epicoxal sulcus: indicated by crenulae or indistinguishable from rugose sculpture. Metapleural structure: not divided into anterior and posterior areas. Sculpture of dorsal metapleural area: transversely striate. Sculpture of ventral metapleural area: irregularly rugose.

Metasoma: Macrosculpture of T1: longitudinally striate, smooth along posterior margin. Setation of T1: present lateral and posterior to lateral pit of T1. Setation of T2–T5: dense in lateral part of tergite, absent medially except for a transverse line of sparse setae along posterior margin. Posterior margin of T6: concave. Sculpture of T2–T4: finely reticulate with a smooth band along posterior margin. Sculpture of S2: finely reticulate. Setation of laterotergites: present. Transverse sulcus on anterior S2: present as a line of small foveae.

Etymology

The species epithet “aetherium” derives from Latin, meaning of the sky or heavens, and refers to the unexpected appearance of this species in North America, far from its native range.

Diagnosis

Gryon aetherium is best separated from other Gryon species by the following characters: mesopleural carina entirely absent or present only at ventral apex of mesopleuron; posterior margin of mesoscutellum protruding posteriorly, concealing metascutellum and metanotal trough in dorsal view; mesopleuron with two episternal foveae; foveae of mesepimeral sulcus attenuating in size dorsally, foveae small or undefined posterior to speculum; acetabular carina and ventral mesopleural carina intersecting ventrally; metapleuron not transversely striate throughout; fore wing with infuscation posterior to marginal vein; hind tibia with four subgenual spines; lateral propodeal carina horizontal, extending laterally to metapleural carina.

In North America, Gryon aetherium is most similar to G. myrmecophilum, from which it is most easily separated by the mesopleural carina: complete in G. myrmecophilum, extending from the posteroventral apex of the femoral depression to the anterior margin of the mesopleuron; absent or present only at ventral apex of mesopleuron in G. aetherium. This character also serves well to separate G. aetherium from G. gonikopalense (Figures 77–78) G. fasciatum (73–76), and G. oligomerum Kononova, which are Old World species that are very similar to G. aetherium but have a complete mesopleural carina.

Intraspecific variation

Non-target testing of G. aetherium in quarantine enabled us to examine how different hosts affect the phenotype of the parasitoids. Overall, we found very little variation between specimens of G. aetherium reared from Bagrada hilaris, Thyanta custator, Holcostethus, Banasa sordida and Euschistus conspersus (Figures 67, 69–72). The sculpture of the dorsal metapleural area varies from transversely striate to irregularly rugose. The foveae that comprise the mesepimeral sulcus decrease in size dorsally, and posterior to the speculum these foveae can be small and circular or poorly defined. Only one male specimen emerged from eggs of Banasa sordida (Figure 71), which was unusual in that the femoral depression was faintly microsculptured and the foveae of the paracoxal sulcus were shallow and not well-defined. This specimen also had malformed antennae, suggesting that Banasa sordida is not a suitable host for G. aetherium.

Prior misidentifications

Gryon aetherium was misidentified twice by the first author: as G. gonikopalense in Martel et al. (2019) and this name was subsequently used in Martel and Sforza (2021), Tofangsazi et al. (2020) and Hougardy and Hogg (2021), and as G. myrmecophilum in Felipe-Victoriano et al. (2019). The morphological limits of G. aetherium were unclear at the time that these names were used, resulting in a hesitancy to describe it as a new species, especially because not all relevant types had been examined.

Adventive populations

As implied by the previous paragraph, G. aetherium has been present in Mexico since at least June of 2018 and the study by Felipe-Victoriano et al. (2019) is thus the first record of this species in North America. It appears that G. aetherium has been in the United States for a similar length of time given that specimens were recovered from two locations in California: Davis, Yolo County, in 2020, and Monterey County, in 2018 and 2019. In both cases the specimens were reared from B. hilaris sentinel egg masses. A specimen from the 2018 collection (FSCA 00033319:PL11) was sequenced to confirm its identity (Figure 4). It differed from the quarantine populations by three base pairs, alleviating concerns that it represented escapees. The specimens collected in Monterey were stored in isopropanol, which affected the color of the specimens (Figure 68) and degraded the DNA. We were not able to amplify COI from the specimens collected in Monterey, but our morphological analysis using scanning electron microscopy finds them to be identical to the specimens in quarantine and those that were retrieved in Yolo County. In 2021, a population of G. aetherium was recovered in Chile, reared from the eggs of B. hilaris (Rojas-Gálvez et al. 2021).

Material examined

Holotype, female: Pakistan: Punjab, Toba Tek Singh, Dabanwala leg. R. Mahmood, coll. 5–9.IV.2016, ex. eggs Bagrada hilaris 11-V-2016 on mustard, introduced to quarantine for EBCL colony, PP8, USNMENT01335778 (deposited in USNM). Paratypes (72 females, 37 males): Mexico: 9 females, 3 males, FSCA 000900442–00090443, 000900446–00090447, 000900468–00090475 (FSCA). Pakistan: 19 females, 8 males, FSCA 00033215–00091216, 00091221, 00094940–00094944, 00094984–00094992; USNMENT00989933, 01109043, 01109046–01109047, 01109049, 01109052, 01109054–01109155, 01335774, 01335776 (USNM). United States: 44 females, 26 males, FSCA 00033319, 00090933, 00091210, 00091217,00091930, 00094869, 00094871, 00094873–00094874, 00094877, 00094885, 00094899, 00094901–00094903, 00094945– 00094981, 00094983, 00094993–00095009 (FSCA).

Gryon africanum Mineo

Gryon africanum Mineo, 1991: 19 (original description, assigned to myrmecophilum species group).

Gryon amphiboli Mineo

Gryon amphiboli Mineo, 1991: 19 (original description, assigned to myrmecophilum species group).

Comments

This species remains in Gryon based on its assignment to the myrmecophilum species group.

Gryon amplum (Dodd)

Hadronotus amplus Dodd, 1914b: 81 (original description); Dodd, 1915: 20 (keyed); Kieffer, 1926: 455, 471 (description, keyed).

Mirotelenomus amplus (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information).

Gryon amplum (Dodd): Caleca & Mineo, 1995: 19 (generic transfer).

Comments

The original description states “Head and thorax very finely reticulate rugulose” which is consistent with placement in Gryon if it is referring to microsculpture. However, it also states “club 6-jointed”, which suggests Hadronotus. Because it is presently unclear where this species belongs, we leave it in its current placement.

Gryon angustipenne (Dodd)

Telenomoides angustipennis Dodd, 1913a: 169, 171 (original description, keyed).

Hadronotus angustipennis (Dodd): Dodd, 1914a: 129 (generic transfer); Dodd, 1915: 20 (keyed); Kieffer, 1926: 456, 471 (description, keyed).

Mirotelenomus angustipennis (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information).

Gryon angustipenne (Dodd): Caleca & Mineo, 1995: 19 (generic transfer).

Comments

The holotype specimen has a 4-merous clava, the carina adjacent to the lateral pit on T1 is clearly visible, and the striation inside the axillar crescent is visible in the image of the right side. These characters, combined with the lack of macrosculpture on the head and dorsal mesosoma, enable us to confidently place this species in Gryon.

Gryon anna Kozlov & Kononova

Gryon anna Kozlov & Kononova, 1989: 80, 96 (original description, keyed); Kozlov & Kononova, 1990: 268, 298 (description); Johnson, 1992: 379 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 332, 428 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

Two characters from the original description suggest that this species belongs in Gryon: “Frontal depression not shallow, streaked with very fine arcuate wrinkles. The head is fine-grained.” and Figure 15 illustrates a 4-merous clava.

Gryon arabicum (Caleca), comb. nov.

Breviscelio arabicus Caleca, 1990b: 140 (original description); Caleca, 1992: 52, 53 (type information, keyed).

Gryon ariantum Kozlov & Kononova

Gryon ariantum Kozlov & Kononova, 2004: 196 (original description); Kononova & Kozlov, 2008: 329, 402 (description, keyed).

Comments

We leave this species in Gryon until the type specimen can be examined directly. Figure 36 in Kozlov and Kononova (2004) illustrates a 4-merous clava, but the original description is otherwise not informative.

Gryon artum (Kozlov), comb. rev.

Mirotelenomus artus Kozlov, 1963a: 356 (english translation of original description, keyed); Kozlov, 1963b: 664 (original description, keyed); Szabó, 1966: 440 (description); Kozlov, 1978: 621 (description).

Exon artus (Kozlov): Masner, 1980: 22 (generic transfer); Kozlov & Kononova, 1990: 309 (description, keyed); Kononova & Petrov, 2002: 57 (keyed); Fabritius & Popovici, 2007: 41 (description).

Gryon artus (Kozlov): Mineo, 1980a: 200 (generic transfer).

Gryon artum (Kozlov): Mineo & Caleca, 1987b: 49 (emendation, keyed); Johnson, 1992: 379 (cataloged, type information); Mineo & Caleca, 1994: 122 (distribution).

Exon artum (Kozlov): Kononova & Kozlov, 2008: 447, 449 (description, keyed, generic transfer); Timokhov, 2019a: 15 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

Kozlov (1963a) presented some characters that indicate that this species belongs in Gryon: mandibles bidentate, “Head, surface of thorax... with delicate alveolate sculpturing”. Figures 9–9 and 915 in this description illustrate reduced wing venation that is noteworthy.

Gryon austrafricanum Mineo

Gryon austrafricanum Mineo, 1979a: 236 (original description); Mineo & Caleca, 1987b: 47 (description of male); Mineo, 1990: 47 (distribution); Johnson, 1992: 379 (cataloged, type information).

Comments

The original description is largely inadequate for generic placement, but it states that the mandibles are bidentate, which is consistent with this as a species of Gryon.

Gryon brevipenne (Harrington)

Figures 113–116; Holotype images in MBD: CNC No. 2523

Hadronotus brevipennis Harrington, 1900: 188 (original description); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 465 (description, keyed).

Gryon brevipennis (Harrington): Muesebeck & Masner, 1967: 299 (generic transfer); Sarazin, 1986: 973 (type information).

Gryon brevipenne (Harrington): Masner, 1983: 135, 166 (description, emendation, lectotype designation, keyed); Johnson, 1992: 380 (cataloged, type information).

Gryon brevium Kononova

Gryon brevior Kononova, 2005: 1358 (original description); Kononova, Pavlicek & Nevo, 2005: 816 (description).

Gryon brevius Kononova: Kononova & Kozlov, 2008: 328, 394 (description, keyed).

Comments

This species remains in Gryon based on images of the holotype specimen that illustrate the striate axillula, glabrous metapleuron, and subgenual spines on the hind tibia.

Gryon californicum (Masner), comb. rev.

Figures 51–53; Paratype images in MBD: USNMENT01109308

Exon californicum Masner, 1980: 22 (original description).

Gryon californicum (Masner): Mineo & Caleca, 1987b: 49, 50 (generic transfer, keyed); Johnson, 1992: 380 (cataloged, type information).

Gryon callidum Kozlov & Kononova

Gryon callidum Kozlov & Kononova, 2004: 197 (original description); Kononova & Kozlov, 2008: 332, 430 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon caudatum Kozlov & Kononova

Gryon caudatum Kozlov & Kononova, 2004: 197 (original description); Kononova & Kozlov, 2008: 326, 373 (description, keyed).

Comments

This species remains in Gryon based on the abstract of Kozlov and Kononova (2004) which states that it is close to G. simile, Figure 27 in that publication, which illustrates a frontal depression without transverse sculpture, and Figure 37, which illustrates a 4-merous clava.

Gryon chrysolaum (Walker)

Telenomus chrysolaus Walker, 1839: 80 (original description).

Hadronotus chrysolaus (Walker): Dodd, 1920a: 352 (generic transfer).

Liophanurus chrysolaus (Walker): Kieffer, 1926: 66, 84 (description, generic transfer, keyed).

Gryon chrysolaus (Walker): Masner, 1965: 75 (type information, generic transfer).

Gryon chrysolaum (Walker): Johnson, 1992: 381 (cataloged, type information).

Comments

The genus cannot be determined from the original description and examination of the primary type is required.

Gryon conicum Kozlov & Kononova

Gryon conicus Kozlov & Kononova, 1989: 79, 89 (original description, keyed); Kozlov & Kononova, 1990: 267, 282 (description, keyed); Kononova & Petrov, 2002: 55 (keyed).

Gryon conicum Kozlov & Kononova: Johnson, 1992: 381 (cataloged, type information); Kononova & Kozlov, 2008: 327, 381 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

This species remains in Gryon, largely because we cannot reliably determine its genus without examination of the type specimen. Our translation of the original description is as follows. “Frontal impression superficial, with very thin arcuate wrinkles. The head is fine-grained.” This is congruent with Gryon if the arcuate wrinkles refer to lines of microsculpture.

Gryon consocium Mineo

Gryon consocium Mineo, 1991: 20 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 119 (distribution).

Gryon coracinum (Fouts)

Holotype images in MBD: USNMENT00989057

Synteleia coracina Fouts, 1927: 178 (original description).

Gryon coracinus (Fouts): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (type information).

Gryon coracinum (Fouts): Masner, 1983: 135, 172 (description, emendation, keyed); Johnson, 1992: 381 (cataloged, type information).

Gryon cornutum Kononova & Petrov

Gryon cornutus Kononova & Petrov, 2001: 1471 (original description); Kononova & Petrov, 2002: 53 (keyed).

Gryon cornutum Kononova & Petrov: Kononova & Kozlov, 2008: 323, 349 (description, keyed).

Comments

This species remains in Gryon, albeit without great confidence, based on the original description: “Fine-grained head sculpture. The forehead has a well-defined frontal depression. The latter has a longitudinal carina, shining, with strongly smoothed grain.” Figure 15 illustrates a female antenna with four clavomeres.

Gryon crassifemoratum Mineo

Gryon crassifemoratum Mineo, 1990a: 181 (original description. Misspelled crasifemaratum in description, abstract; correct spelling (G. Mineo) in title); Johnson, 1992: 381 (cataloged, type information).

Comments

The original description for this species is woefully insufficient. We leave it in Gryon based on its placement in the myrmecophilum species group (Mineo 1990).

Gryon crenatum (Sundholm)., comb. nov.

Breviscelio crenatus Sundholm, 1970: 383 (original description); Caleca, 1990b: 141 (description); Johnson, 1992: 355 (cataloged, type information); Caleca, 1992: 51, 53 (description, keyed).

Gryon cultratum (Kozlov), comb. nov.

Eremioscelio cultratus Kozlov, 1971: 49 (original description); Kozlov, 1972: 656 (keyed); Kozlov, 1978: 622 (description); Kozlov & Kononova, 1990: 311, 312 (description, keyed); Johnson, 1992: 373 (cataloged, type information); Kononova & Kozlov, 2008: 451, 453 (treated as valid species, description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

This synonymy of Eremioscelio with Gryon implicitly transfers this species. The transfer of Gryon cultratus Masner to Hadronotus means that homonomy is avoided.

Figures 29–34. 

Gryon cydnoide 29 holotype female (USNMENT01059665), head and mesosoma, anterior view 30 female (OSUC 395743) head, anterior view 31 holotype female (USNMENT01059665), habitus, dorsal view 32 female (OSUC 395739), habitus, dorsolateral view 33 holotype female, habitus, lateral view 34 mesosoma and T1, dorsolateral view.

Figure 35–40. 

Gryon moczari 35 female (CNC664036), head, anterior view 36 holotype female, head and mesosoma, lateral view 37 female (CNC664036), head and mesosoma, dorsolateral view 38 female (CNC664036), metasoma, dorsal view 39 female (CNC664036), antennal clava, ventrolateral view 40 female (CNC664036), wings, dorsal view.

Figures 41–46. 

Gryon crenatum 41 holotype female (MZLU Type no. 911:1), habitus, dorsolateral view 42 female (SAM-HYM-P093658), head, anterior view 43 female (SAM-HYM-P093675), head and mesosoma, lateral view 44 female (SAM-HYM-P093658), head, lateral view 45 female (SAM-HYM-P093658), fore tarsus, lateral view 46 female (SAM-HYM-P093658), subgenual spines on hind tibia, posterolateral view.

Gryon cydnoide (Priesner), comb. rev.

Figures 29–34; Holotype images in MBD: USNMENT01059665

Hadronotus bernardi Maneval, 1940: (original description); Mineo, 1991: 9 (name considered to be unavailable).

Eremioscelio cydnoides Priesner, 1951: 130 (original description); Kozlov, 1963a: 357 (description); Kozlov, 1963b: 666 (description); Kozlov, 1971: 49 (description); Kozlov, 1972: 656 (keyed); Kozlov, 1978: 62 (description); Mineo & Villa, 1982b: 134 (taxonomic value of structures on the posterior surface of the head); Mineo & Villa, 1982a: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Kozlov & Kononova, 1990: 311 (description, keyed); Johnson, 1992: 373 (cataloged); Notton, 2006: 195 (distribution); Fabritius & Popovici, 2007: 36, 39 (description, keyed); Kononova & Kozlov, 2008: 451, 452 (description, keyed, generic transfer).

Eremioscelio bernardi (Maneval): Masner, 1976: 59 (generic transfer, description); Mineo, 1991: 9 (junior synonym of Gryon cydnoide (Priesner)); Johnson, 1992: 373 (cataloged, type information).

Gryon cydnoide (Priesner): Mineo, 1991: 9 (generic transfer, synonymy); Mineo & Caleca, 1994: 126 (distribution); Timokhov, 2019a: 14 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon delucchii Mineo & Szabó

Gryon delucchii Mineo & Szabó, 1978a: 88 (original description); Mineo & Gatto, 1981: 187 (description of preimaginal stages); Johnson, 1992: 381 (cataloged, type information); Kononova & Kozlov, 2008: 331, 425 (description, keyed).

Gryon dicaeum (Walker)

Telenomus dicaeus Walker, 1839: 80 (original description).

Microphanurus dicaeus (Walker): Kieffer, 1926: 93, 109 (description, generic transfer, keyed).

Gryon dicaeus (Walker): Masner, 1965: 75 (type information, generic transfer).

Gryon dicaeum (Walker): Johnson, 1992: 381 (cataloged, type information).

Comments

We are unable to determine from the original description if this species belongs in Hadronotus or Gryon and leave its generic placement unchanged until examination of the type specimen occurs.

Figures 47–50. 

47 Encyrtoscelio (OSUC 334153), head, lateral view 48 Tyrannoscelio genieri Masner & Johnson (OSUC 545772), head and mesosoma, lateral view 49 Acanthoscelio (OSUC 232241), head, anterior view 50 Sparasion philippinensis (USNMENT00872835), head, anterior view.

Figures 51–53. 

Gryon californicum, paratype female (USNMENT01109308) 51 habitus, lateral view 52 head, anterior view 53 metasoma, dorsal view.

Gryon dichropterum Kozlov

Gryon dichropterus Kozlov, 1966: 144 (original description); Mineo, 1980a: 191 (description of male); Johnson, 1992: 382 (cataloged, type information).

Eremioscelio dichropterus (Kozlov): Kozlov, 1972: 657 (generic transfer, keyed); Kozlov, 1978: 622 (description); Kozlov & Kononova, 1990: 311, 318 (description, keyed); Kononova & Kozlov, 2008: 452, 458 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon dichropterum Kozlov: Mineo & Caleca, 1994: 127, 128 (distribution, keyed).

Gryon dispar Kononova & Petrov

Gryon dispar Kononova & Petrov, 2001: 1479 (original description); Kononova & Petrov, 2002: 57 (keyed); Kononova & Kozlov, 2008: 333, 436 (description, keyed).

Comments

We were not able to determine from the original description if this species belongs in Gryon or Hadronotus. Its placement thus remains unchanged.

Figures 54–57. 

Gryon aetherium 54 holotype female (USNMENT01335778), head, anterior view 55 female (FSCA 00090468), wings, dorsal view 56 holotype female (USNMENT01335778), head, mesosoma, metasoma, lateral view 57 holotype female (USNMENT01335778), head, mesosoma, metasoma, dorsolateral view.

Figures 58. 

Gryon aetherium, female (USNMENT01109155), habitus, ventrolateral view.

Gryon elatior Masner

Holotype images in MBD: CNC No. 17019

Gryon elatior Masner, 1983: 135, 173 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 382 (cataloged, type information).

Gryon elongatum Mineo, comb. rev.

Gryon elongatum Mineo, 1991: 22 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 119 (distribution).

Gryon mineoi Özdikmen: Özdikmen, 2011: 772 (replacement name for Gryon elongatum Mineo).

Comments

The transfer of Hadronotus elongatus Risbec back to Hadronotus makes the replacement name no longer necessary for this species.

Gryon eremiogryon Mineo

Gryon eremiogryon Mineo, 1979a: 241 (original description); Mineo, 1979b: 96 (keyed); Johnson, 1992: 382 (cataloged); Kononova & Kozlov, 2008: 333, 440 (description, keyed).

Comments

The original description stated that G. eremiogryon has bidentate mandibles and the subsequent discussion expressed Mineo’s idea that G. eremiogryon was intermediate between Gryon and Eremioscelio. Given that the latter is now treated as a junior synonym of Gryon, we are fairly confident that this species belongs in Gryon.

Figures 59–66. 

Gryon aetherium 59 female (FSCA 00094873), head, anterior view 60 female (FSCA 00094869), head, posterolateral view 61 female (FSCA 00094873), antennal clava, lateral view 62 female (FSCA 00094869), mesosoma, ventral view 63 female (FSCA 00094873), mesosoma, dorsolateral view 64 female (FSCA 00094874), mesosoma, anterolateral view 65 female (FSCA 00094874), mesosoma, posterolateral view 66 female (FSCA 00094871), hind tibia, dorsal view.

Figures 67–72. 

Gryon aetherium, lateral habitus 67 female (FSCA 00094902), ex. Bagrada hilaris 68 female (FSCA 00094885), ex. Bagrada hilaris 69 female (FSCA 00094903), ex. Holcostethus 70 female (FSCA 00094899), ex. Thyanta custator 71 male (FSCA 00094877), ex. Banasa sordida 72 male (FSCA 00094901), ex. Euschistus conspersus.

Gryon excertum Kononova & Fursov

Gryon excertus Kononova & Fursov, 2005a: 595 (original description); Kononova & Fursov, 2005b: 304 (description).

Gryon excertum Kononova & Fursov: Kononova & Kozlov, 2008: 329, 409 (description, keyed).

Comments

The original and subsequent descriptions suggest the species should remain in Gryon, but it is not entirely clear: “The head sculpture is fine-meshed. Head with short, dense hairs arranged horizontally. The frontal depression above the antennae and the longitudinal frontal carina are absent. Fan-shaped wrinkles on cheeks.”

Gryon fasciatum (Priesner)

Figures 73–76; Holotype images in MBD: USNMENT01059667; Images of paratype: https://zenodo.org/record/4837467#.YLExBPlKhaQ

Hadronotus fasciatus Priesner, 1951: 130 (original description); Mineo, 1980b: 214 (type information).

Gryon fasciatus (Priesner): Kozlov, 1978: 619 (description, generic transfer); Kozlov & Kononova, 1989: 81 (keyed); Kozlov & Kononova, 1990: 269, 303 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Pintureau & al-Nabhan, 2003: 5 (new distribution record from France and Middle East (Syria)); Fabritius & Popovici, 2007: 15, 29 (description, keyed).

Gryon fasciatum (Priesner): Mineo, 1991: 23 (description, assigned to myrmecophilum species group); Johnson, 1992: 382 (cataloged, type information); Kononova & Kozlov, 2008: 332, 434 (description, keyed); Timokhov, 2019a: 15 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon firmum Mineo

Gryon firmum Mineo, 1991: 26 (original description, assigned to myrmecophilum species group).

Gryon flaviventre Kononova

Gryon flaviventris Kononova, 2001: 1469 (original description); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 14, 17 (description, keyed).

Gryon flaviventre Kononova: Kononova & Kozlov, 2008: 323, 345 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

This species remains in Gryon based on the original description, “The head sculpture is grainy. The frontal depression is weakly expressed, its sculpture is slightly smoothed” and Figure 12, which illustrates a female antenna with four clavomeres.

Figures 73–76. 

Gryon fasciatum 73 holotype female (USNMENT01059667), habitus, dorsolateral view 74 paratype female (USNMENT01109130), habitus, lateral view 75 paratype female (USNMENT01109130), head and mesosoma ventral view 76 paratype female (USNMENT01109130), mesosoma, posterolateral view.

Figures 77–78. 

Gryon gonikopalense, holotype female (USNMENT01109129) 77 habitus, lateral view 78 mesosoma, lateral view.

Gryon flavum (Dodd)

Hadronotus flavus Dodd, 1913b: 172 (original description); Dodd, 1915: 18 (keyed); Kieffer, 1926: 455, 469 (description, keyed).

Gryon flavus (Dodd): Galloway, 1976: 91 (type information, generic transfer).

Gryon flavum (Dodd): Johnson, 1992: 383 (cataloged, type information).

Comments

The original description is insufficient for generic placement. We leave this species in Gryon and note that the holotype female needs to be examined.

Gryon fumosum (Dodd)

Hadronotus fumosus Dodd, 1914a: 130 (original description); Dodd, 1915: 20 (keyed); Kieffer, 1926: 455, 472 (description, keyed).

Mirotelenomus fumosus (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 109 (type information).

Gryon fumosus (Dodd): Galloway & Austin, 1984: 79 (generic transfer).

Gryon fumosum (Dodd): Mineo, 1990a: 180 (emendation, systematic position); Johnson, 1992: 383 (cataloged, type information).

Gryon fuscum Kononova

Gryon fuscus Kononova, 2001: 1477 (original description); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 29, 68 (keyed).

Gryon rutilator Kononova: Kononova & Kozlov, 2008: 328, 391 (replacement name, description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).

Comments

The original description lists a few characters that indicate that this species belongs in Gryon, “The head sculpture is fine-grained. Frontal depression not shiny, with strongly smoothed grain.” Plastogryon fuscus Dodd is now treated as a junior synonym of Hadronotus flavipes. The replacement name, Gryon rutilator Kononova, is thus no longer needed for this species.

Gryon gloriosum Kozlov & Kononova

Gryon gloriosum Kozlov & Kononova, 2004: 200 (original description); Kononova & Kozlov, 2008: 332, 425 (description, keyed).

Comments

We consider it most likely that this species belongs in Gryon based on the comparisons to G. hungaricum and G. laetum in the abstract of the original description.

Gryon goethei (Girault)

Hadronotus goethei Girault, 1932: 5 (original description); Galloway, 1976: 111 (type information, status uncertain); Gordh, Menke, Dahms & Hall, 1979: 297 (reprint of Girault (1932)); Johnson, 1992: 510 (cataloged, type information).

Comments

The description of this species is insufficient for generic placement and examination of the holotype specimen is required.

Gryon gonikopalense Sharma

Figures 77–78; Holotype images in MBD: USNMENT01109129

Gryon gonikopalensis Sharma, 1982: 327, 336 (original description, keyed).

Gryon gonikopalense Sharma: Johnson, 1992: 384 (cataloged).

Gryon gorines Kozlov & Lê

Holotype images in MBD: IEBR 0177

Gryon gorines Kozlov & Lê, 1992: 210, 212, 221 (original description, assigned to misellum species group, keyed).

Gryon gorinis Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 116 (description, keyed, type information).

Gryon grande Kononova & Petrov

Gryon grandis Kononova & Petrov, 2001: 1476 (original description); Kononova & Petrov, 2002: 55 (keyed).

Gryon grande Kononova & Petrov: Kononova & Kozlov, 2008: 327, 388 (description, keyed).

Comments

This species remains in Gryon based on the original description, “Head sculpture fine-grained. Frontal depression shallow, not wide, shining, with distinct longitudinal carina. Frons up to anterior ocellus with fine-grained sculpture” and Figure 23 which illustrates a 4-merous clava.

Gryon grownum Kozlov & Lê

Gryon grownum Kozlov & Lê, 1992: 212, 221 (original description, assigned to misellum species group, keyed).

Gryon grownus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 117 (description, keyed, type information).

Gryon gryonis Mineo

Gryon gryonis Mineo, 1990a: 172 (original description); Johnson, 1992: 384 (cataloged, type information).

Comments

The holotype specimen is very small, only about 0.7 mm in length, and is light in color. This makes it challenging to illustrate and interpret characters with brightfield photography. We believe that this species should remain in Gryon based on the apparently 4-merous clava, absence of transverse sculpture in the frontal depression, the glabrous metapleuron that is not dorsoventrally divided by sculpture or setation, and the presence of subgenual spines on the hind tibia (Figures 79–82). The lateral pit on T1 appears to be present but is difficult to discern. The shape of the clypeus and the presence of striation inside the axillar crescent could not be reliably determined from the images of the anterior head and lateral mesosoma, respectively (Figures 79, 81).

Figures 79–82. 

Gryon gryonis, holotype female 79 habitus, lateral view 80 mesosoma and T1, lateral view 81 head, anterior view 82 head and mesosoma, anterolateral view.

Gryon hospes Kieffer

Plesiobaeus Hospes Kieffer, 1913: 283 (original description).

Plesiobaeus hospes Kieffer: Kieffer, 1926: 556 (description); Masner, 1965: 89 (type information); Kozlov, 1978: 621 (description); Kozlov & Kononova, 1990: 307 (description); Fabritius & Popovici, 2007: 34 (description); Kononova & Kozlov, 2008: 445 (description).

Gryon hospes (Kieffer): Mineo, 1979: 248 (description, generic transfer); Mineo & Caleca, 1987: 53 (description); Johnson, 1992: 384 (cataloged, type information).

Gryon howardi (Mokrzecki & Ogloblin)

Hadronotus howardi Mokrzecki & Ogloblin, 1931: 1 (original description); Masner, 1958: 42 (keyed); Loiácono & Díaz, 1996: 9 (type information).

Hadronotellus howardi (Mokrzecki & Ogloblin): Szabó, 1966: 422, 424 (description of male and female, generic transfer, keyed).

Gryon howardi (Mokrzecki & Ogloblin): Kozlov, 1978: 620 (description, generic transfer); Mineo, 1980a: 193 (description); Kozlov & Kononova, 1989: 78 (keyed); Kozlov & Kononova, 1990: 266, 271 (description, keyed); Johnson, 1992: 384 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 15, 22 (description, keyed); Kononova & Kozlov, 2008: 325, 366 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

Figure 3 of the original description clearly illustrates the presence of subgenual spines, confirming that this species belongs in Gryon.

Gryon hungaricum (Szabó)

Pannongryon hungaricum Szabó, 1966: 435, 436 (original description, keyed).

Gryon prolongatus Kozlov, 1971: 48 (original description. Synonymized by Mineo (1980a)); Kozlov, 1978: 620 (description); Mineo, 1980a: 196 (junior synonym of Gryon hungaricum (Szabó)); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 287 (description, keyed); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 14, 20 (description, keyed).

Gryon hungaricum (Szabó): Mineo, 1980a: 196 (generic transfer, synonymy); Mineo, 1991: 10, 12 (description, assigned to hungaricum species group, keyed); Johnson, 1992: 385 (cataloged, type information); Fabritius & Popovici, 2007: 30 (keyed).

Gryon prolongatum Kozlov: Kononova & Kozlov, 2008: 323, 348 (treated as valid species, keyed).

Comments

Mineo (1980a) treated G. prolongatum as a junior synonym of G. hungaricum (Szabó). Kononova & Kozlov (2008) recognized the synonymy of Gryon prolongatus Kozlov and Gryon [Pannongryon] hungaricum (Szabó) but incorrectly used G. prolongatum as the valid name.

Gryon insidiosum Mineo

Gryon insidiosum Mineo, 1991: 27 (original description, assigned to myrmecophilum species group).

Gryon insulare (Dodd), comb. nov.

Telenomoides insularis Dodd, 1913a: 169, 171 (original description. Preoccupied by Hadronotus insularisAshmead (1894)).

Hadronotus assimilis Dodd: Dodd, 1914a: 129 (replacement name, generic name); Dodd, 1915: 20 (keyed); Kieffer, 1926: 456, 472 (description, keyed).

Mirotelenomus assimilis (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information).

Gryon assimile (Dodd): Caleca & Mineo, 1995: 19 (generic transfer).

Comments

The 4-merous clava, shape of the clypeus, bidentate mandibles with large teeth, and fine sculpture of the head and dorsal mesosoma are visible in the slide mounted holotype female. Transfer of Hadronotus insularis Ashmead from Gryon back to Hadronotus makes the replacement species name “assimile” no longer necessary.

Gryon investe (Kieffer)

Plastogryon investis Kieffer, 1908: 143 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Plastogryon Investis Kieffer: Kieffer, 1913: 249 (description).

Plastogryon (Heterogryon) investis Kieffer: Kieffer, 1926: 446, 449 (description, subgeneric assignment, keyed).

Gryon investis (Kieffer): Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 277 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed).

Gryon investe (Kieffer): Kononova & Kozlov, 2008: 326, 377 (treated as valid species, description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

The treatment of Plastogryon investis as a junior synonym of Gryon misellum by Masner (1961) indicates that, at the least, they are congeneric.

Gryon josephinae Mineo

Gryon Josephinae Mineo, 1991: 27 (original description, assigned to myrmecophilum species group).

Gryon josephinae Mineo: Mineo & Caleca, 1994: 119 (distribution).

Gryon justum Kozlov & Kononova

Gryon justus Kozlov & Kononova, 1989: 80, 93 (original description, keyed); Kozlov & Kononova, 1990: 268, 291 (description, keyed); Kononova & Petrov, 2002: 55 (keyed).

Gryon justum Kozlov & Kononova: Johnson, 1992: 385 (cataloged, type information); Kononova & Kozlov, 2008: 329, 404 (description, keyed).

Comments

This species remains in Gryon based on a character listed in the original description “The frontal impression is deep, not striate.”

Gryon kaszabi (Mineo), comb. nov.

Eremioscelio kaszabi Mineo, 1979c: 269 (original description); Johnson, 1992: 373 (cataloged, type information).

Comments

Mineo (1991) transferred Eremioscelio cydnoides (type species of Eremioscelio) to Gryon, implicitly treating Eremioscelio as a junior synonym. A few characters in the original description of E. kaszabi confirm this placement, “club with four joints”, “cheeks and surface of frons...finely, fan-like striate.”

Gryon elegans Kononova

Gryon elegans Kononova, 2001: 1478 (original description); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 331, 423 (description, keyed).

Gryon kononovai Özdikmen: Özdikmen, 2011: 771 (replacement name for Gryon elegans Kononova).

Comments

The original description provides some evidence for leaving this species in Gryon, “The head sculpture is fine-grained, resembles fine emery.” Our transfer of Plastogryon elegans Dodd to Hadronotus eliminates the need for the replacement name Gryon kononovai.

Gryon lada Kozlov

Gryon lada Kozlov, 1972: 651 (original description); Kozlov & Kononova, 1989: 81 (keyed); Kozlov & Kononova, 1990: 269, 305 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 57 (keyed); Kononova & Kozlov, 2008: 333, 438 (description, keyed).

Gryon laetum Kozlov & Kononova

Gryon laetum Kozlov & Kononova, 2004: 201 (original description); Kononova & Kozlov, 2008: 332, 432 (description, keyed).

Comments

Figure 14 in the original description matches the distinct habitus found in many species of Gryon (e.g., G. myrmecophilum) and illustrates a striate interior of the axillula, which is a diagnostic character for the genus.

Gryon lala Kozlov

Gryon lala Kozlov, 1972: 652 (original description); Mineo, 1980a: 197 (systematic relationships); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 288 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova, 1995: 84 (keyed); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 26, 66 (keyed); Kononova & Kozlov, 2008: 326, 376 (description, keyed).

Gryon lamia (Kozlov), comb. nov.

Eremioscelio lamia Kozlov, 1972: 655, 656 (original description, keyed); Kozlov & Kononova, 1990: 311, 315 (description, keyed); Johnson, 1992: 373 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Kozlov, 2008: 452, 455 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon largi (Ashmead)

Lectotype images in MBD: USNMENT00989858

Hadronotus largi Ashmead, 1893: 230, 231 (original description); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 462 (description, keyed).

Gryon largi (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 35 (lectotype designation); Masner, 1983: 135, 169 (description, keyed); Johnson, 1992: 386 (cataloged, type information).

Gryon latum (Kozlov), comb. rev.

Mirotelenomus latus Kozlov, 1963a: 356 (English translation of original description, keyed); Kozlov, 1963b: 664 (original description, keyed, preoccupied by Austroscelio latus Dodd, 1916); Kozlov, 1978: 621 (description); Johnson, 1992: 392 (type information).

Gryon latus (Kozlov): Mineo, 1979a: 255 (generic transfer).

Exon latus (Kozlov): Masner, 1980: 22 (generic transfer); Kozlov & Kononova, 1990: 308, 309 (description, keyed); Kononova & Petrov, 2002: 57 (keyed).

Gryon latum (Kozlov): Mineo & Caleca, 1987b: 49, 50 (diagnosis, keyed).

Gryon kozlovi Mineo: Mineo, 1990a: 171 (unnecessarily proposed replacement name).

Exon latum (Kozlov): Kononova & Kozlov, 2008: 447 (description, keyed, generic transfer).

Comments

Our treatment of Exon as a junior synonym of Gryon implicitly transfers this species.

Gryon lena Kozlov

Gryon lena Kozlov, 1972: 655 (original description); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 289 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova & Petrov, 2002: 55 (keyed); Kononova & Kozlov, 2008: 328, 398 (description, keyed).

Comments

This species remains in Gryon based on the redescription in Kozlov & Kononova (1990): “The frontal depression above the antennae is deep, with finely sculpted sculpture. The head sculpture is fine-grained.” However, we consider it necessary for the holotype specimen to be examined for confident placement.

Gryon longipenne (Dodd)

Platyteleia longipennis Dodd, 1913c: 335 (original description); Kieffer, 1926: 409 (description, keyed); Galloway, 1976: 101 (type information).

Gryon longipennis (Dodd): Galloway & Austin, 1984: 79 (generic transfer).

Gryon longipenne (Dodd): Mineo, 1990b: 58 (type information); Johnson, 1992: 387 (cataloged, type information).

Comments

Generic placement cannot be determined from the original description and examination of the holotype is needed.

Gryon lymantriae (Masner), comb. rev.

Hadronotus lymantriae Masner, 1958: 39, 42 (original description, keyed).

Gryon lymantriae (Masner): Masner, 1965: 77 (type information, generic transfer); Mineo, 1979a: 257 (description); Johnson, 1992: 387 (cataloged, type information); Mineo & Caleca, 1994: 127, 128 (distribution, keyed, synonymy).

Masneria lymantriae (Masner): Szabó, 1966: 442 (description of male and female, generic transfer).

Eremioscelio lymantriae (Masner): Kozlov, 1972: 657 (generic transfer, keyed); Kozlov, 1978: 622 (description); Livshits & Kuslitskii, 1989: 49 (keyed); Kozlov & Kononova, 1990: 311, 316 (description, keyed); Fabritius & Popovici, 2007: 36 (description, keyed); Kononova & Kozlov, 2008: 452, 456 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon maculatum Kozlov & Kononova

Gryon maculatum Kozlov & Kononova, 2004: 201 (original description); Kononova & Kozlov, 2008: 328, 400 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

The original description suggests that this species belongs in Gryon, but is not entirely clear, “The head is fine-grained. The second impression is distinct, with a longitudinal carina, in fine-grained ornamentation.”

Gryon magnum Kozlov & Kononova

Gryon magnus Kozlov & Kononova, 1989: 81, 99 (original description, keyed); Kozlov & Kononova, 1990: 269, 304 (description, keyed); Kononova & Petrov, 2002: 57 (keyed).

Gryon magnum Kozlov & Kononova: Johnson, 1992: 388 (cataloged, type information); Kononova & Kozlov, 2008: 333, 436 (description, keyed).

Comments

This species remains in Gryon based on the original description: “The frontal depression is shallow, with finer, significantly smoothed granularity. The forehead and the vertex are coarse-grained.”

Gryon marina Kozlov & Kononova

Gryon marina Kozlov & Kononova, 1989: 81, 97 (original description, keyed); Kozlov & Kononova, 1990: 269, 301 (description, keyed); Johnson, 1992: 388 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 332, 433 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

We consider it best to leave this species in Gryon based on characters in the original description, “The head is finely meshed” and “Cheeks from above in thin longitudinal wrinkles.”

Gryon medium Kononova & Petrov

Gryon medius Kononova & Petrov, 2001: 1476 (original description); Kononova & Petrov, 2002: 55 (keyed).

Gryon medium Kononova & Petrov: Kononova & Kozlov, 2008: 327, 386 (description, keyed).

Comments

The original description illustrates a female antenna with four clavomeres and describes the sculpture of the frontal depression as “smoothed.”

Gryon menthes Kozlov & Lê

Holotype images in MBD: ZIN 0092; Paratype images in MBD: USNMENT01223670

Gryon menthes Kozlov & Lê, 1992: 220, 221 (original description, assigned to misellum species group, keyed).

Gryon menthis Kozlov & Lê, 1996: 9 (description); Lê, 2000: 96, 123 (description, keyed, type information).

Comments

Images of the paratype specimens show the presence of striation of the axillula and the lateral pit on T1.

Gryon micropterum (Kieffer)

Hadronotus brevipennis Kieffer, 1909: 270 (original description. Preoccupied by Hadronotus brevipennisHarrington (1900)).

Hadronotus Micropterus (Kieffer): Kieffer, 1913: 244 (replacement name).

Hadronotus micropterus (Kieffer): Kieffer, 1926: 453, 457 (description, keyed); Bin, 1974: 455 (type information).

Gryon micropterus (Kieffer): Johnson, 1992: 388 (cataloged, type information).

Comments

The original description is insufficient for generic placement. We leave this species in its current placement until the holotype can be examined.

Gryon minutum Mineo

Gryon minimum Mineo, 1990a: 173 (original description. Preoccupied by Hadronotus minimusKieffer (1908)); Johnson, 1992: 388 (cataloged, type information).

Gryon minutum Mineo: Mineo, 1991: 7 (replacement name for Gryon minimum Mineo, assigned to artum species group).

Gryon minimum (Kieffer)

Hadronotus minimus Kieffer, 1908: 35 (original description); Kieffer, 1926: 455, 467 (description, keyed).

Gryon minimus (Kieffer): Alayo Dalmau, 1973: 99 (cataloged).

Gryon minimum (Kieffer): Johnson, 1992: 388 (cataloged).

Comments

The original description suggests that this species belongs in Gryon and so we leave it here for now, albeit without great confidence: “head wider than thorax, slightly arched back, twice as wide as long, smooth and shiny on the front which gives an unlimited frontal impression, finely chagrined on the rest.”

Gryon mirum Kononova & Petrov

Gryon mirus Kononova & Petrov, 2001: 1477 (original description); Kononova & Petrov, 2002: 55 (keyed).

Gryon mirum Kononova & Petrov: Kononova & Kozlov, 2008: 327, 389 (description, keyed).

Comments

This species remains in Gryon based on the original description, “frontal impression with granular, strongly smoothed sculpture, shining.”

Gryon misellum Haliday

Figures 21, 22–23, 24–25; Lectotype images: https://zenodo.org/record/4498847#.YB2OJmFKhaQ Paralectotype images: https://zenodo.org/record/4724052#.YIh-SPlKhaQ

Gryon misellum Haliday, 1833: 271 (original description, keyed); Kieffer, 1926: 261 (description, keyed); Mineo, 1980a: 197 (variation); Masner, 1983: 135, 165 (description, keyed); Mineo & Caleca, 1987b: 44 (taxonomic status of Nearctic specimens); Mineo, 1990: 54 (distribution); Johnson, 1992: 388 (cataloged, type information); Mineo & Caleca, 1994: 120 (distribution); Pintureau & al-Nabhan, 2003: 2 (description, new distribution record from Portugal and France); Kononova & Kozlov, 2008: 326, 378 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Teleas pumilio Nees von Esenbeck, 1834: 288 (original description. Synonymized by Masner (1961)); Dalla Torre, 1898: 519 (generic transfer); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Gryon misellus Haliday: Walker, 1836: 344 (description, emendation); Kieffer, 1908: 190 (description); Masner, 1961: 160 (description, synonymy, lectotype designation); Kozlov, 1963a: 357, 358 (description, keyed); Kozlov, 1963b: 667 (description, keyed); Hellén, 1971: 21 (description); Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 278 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 15, 26 (description, keyed).

Teleas misellus (Haliday): Blanchard, 1840: 290 (description, generic transfer).

Telenomus divisus Wollaston, 1858: 25 (original description. Synonymized by Graham (1984)); Kieffer, 1926: 39 (description); Johnson, 1992: 388 (type information).

Acolus basalis Thomson, 1859: 422 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Acolus opacus Thomson, 1859: 422 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Gryon pumilio (Nees von Esenbeck): Mayr, 1879: 698 (generic transfer).

Plastogryon Försteri Kieffer, 1908: 141 (original description. Synonymized by Masner (1961)); Kieffer, 1913: 246 (description); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Plastogryon pumilio (Nees von Esenbeck): Kieffer, 1908: 144 (generic transfer).

Plastogryon sagax Kieffer, 1908: 142 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Plastogryon sagax var. brevipennis Kieffer, 1908: 143 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Acoloides basalis (Thomson): Brues, 1908: 17 (diagnosis, list of species).

Acoloides opacus (Thomson): Brues, 1908: 17 (diagnosis, list of species).

Paragryon ? Misellus (Haliday): Kieffer, 1910: 99 (generic transfer).

Holacolus Basalis (Thomson): Kieffer, 1912: 107 (description, generic transfer).

Holacolus Opacus (Thomson): Kieffer, 1912: 107 (description, generic transfer).

Gryon Misellus Haliday: Kieffer, 1913: 214 (description).

Gryon Walkeri Kieffer, 1913: 216 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday).

Plastogryon Brevipennis Kieffer: Kieffer, 1913: 247 (description).

Plastogryon Pumilio (Nees von Esenbeck): Kieffer, 1913: 247 (description).

Plastogryon Sagax Kieffer: Kieffer, 1913: 249 (description).

Hadronotus divisus (Wollaston): Dodd, 1920a: 351 (generic transfer).

Gryon walkeri Kieffer: Kieffer, 1926: 261, 262 (description, keyed).

Holacolus basalis (Thomson): Kieffer, 1926: 170 (description, keyed).

Holacolus opacus (Thomson): Kieffer, 1926: 170 (description, keyed).

Plastogryon (Heterogryon) brevipennis Kieffer: Kieffer, 1926: 446, 448 (description, subgeneric assignment, keyed).

Plastogryon (Heterogryon) pumilio (Nees von Esenbeck): Kieffer, 1926: 446, 449 (description, subgeneric assignment, keyed).

Plastogryon (Heterogryon) sagax Kieffer: Kieffer, 1926: 446, 448 (description, subgeneric assignment, keyed).

Plastogryon (Plastogryon) foersteri Kieffer: Kieffer, 1926: 446, 447 (description, subgeneric assignment, keyed).

Gryon divisus (Wollaston): Masner, 1965: 75 (type information, generic transfer).

Gyron misellum Haliday: O’Connor, Nash, Notton & Fergusson, 2004: 25 (misspelling, catalog of Irish species).

Gryon moczari (Szabó), comb. nov.

Figures 35–40; Holotype images in MBD: Hym.Typ.No. 9634, Mus.Budapest

Hungarogryon moczari Szabó, 1966: 443 (original description); Kozlov, 1978: 621 (description); Mineo, 1979: 261 (figure); Kozlov & Kononova, 1990: 320 (keyed); Johnson, 1992: 402 (cataloged, type information); Mineo, 2005: 34 (new distribution record, host presumption); Kononova & Kozlov, 2008: 462 (description).

Comments

See generic synonymy.

Gryon monspeliense (Picard)

Hadronotus monspeliensis Picard, 1924: 107 (original description).

Hadronotus afanasievi Meier, 1949: (original description. reference from Kozlov (1963c). Synonymized by Kozlov (1978)).

Hadronotus afanassievi Meier: Ryakhovskii, 1959: 81 (description).

Hadronotus telengai Ryakhovskii, 1959: 81, 84 (original description, keyed. Synonymized by Kozlov (1963c)); Kozlov, 1963c: 295 (junior synonym of Gryon afanasievi (Meier)); Johnson, 1992: 389 (type information).

Gryon afanasievi (Meier): Kozlov, 1963c: 295, 296 (description).

Hadronotellus monspeliensis (Picard): Szabó, 1966: 423, 427 (description, generic transfer, keyed).

Gryon monspeliensis (Picard): Mineo, 1977: 82 (description of preimaginal stages); Kozlov, 1978: 619 (description, generic transfer); Mineo, 1979a: 258 (type information); Mineo, 1979b: 94 (keyed); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 299 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Fabritius & Popovici, 2007: 16, 32 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon laraichii Mineo: Mineo, 1979b: 94 (original description, keyed); Mineo, 1979a: 255 (description); Johnson, 1992: 386 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Kozlov, 2008: 429 (junior synonym of Gryon monspeliense (Picard)).

Gryon monspeliense (Picard): Johnson, 1992: 389 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Kozlov, 2008: 332, 429 (description, keyed, synonymy).

Gryon montanum (Kieffer)

Hadronotus montanus Kieffer, 1906: 5 (original description).

Hadronotus ? montanus Kieffer: Kieffer, 1908: 145 (redescribed as new).

Psiloteleia montanus (Kieffer): Kieffer, 1926: 452 (description, keyed).

Gryon montanus (Kieffer): Mani & Sharma, 1982: 192 (generic transfer).

Gryon montanum (Kieffer): Johnson, 1992: 390 (cataloged).

Comments

Generic placement cannot be made from the original description. We leave this species in its current designation until the holotype specimen can be examined.

Gryon muscorum Kozlov & Kononova

Gryon muscorum Kozlov & Kononova, 2004: 202 (original description); Kononova & Kozlov, 2008: 327, 380 (description, keyed).

Comments

We were unable to determine the generic placement of this species, and thus it remains in Gryon until the holotype specimen can be examined.

Gryon myrmecophilum (Ashmead)

Holotype images in MBD: USNMENT00989861

Hadronotus myrmecophilus Ashmead, 1893: 230, 232 (original description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 462 (description, keyed).

Gryon myrmecophilus (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (type information).

Gryon myrmecophilum (Ashmead): Masner, 1983: 135, 170 (description, emendation, keyed); Johnson, 1992: 390 (cataloged, type information).

Gryon nigriceps (Dodd)

Hadronotus nigriceps Dodd, 1914b: 81 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 455, 469 (description, keyed).

Mirotelenomus nigriceps (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 109 (type information).

Gryon nigriceps (Dodd): Galloway & Austin, 1984: 79 (generic transfer); Johnson, 1992: 391 (cataloged, type information).

Comments

The head of the holotype male is slide-mounted and crushed. However, the distinctive shape of the clypeus found in Gryon and facial striae are visible on both sides of the head. The image of the dorsal meso- and metasoma shows the carina on T1 that is directly medial to the lateral pit that is diagnostic for Gryon, although the pit itself is not visible. This image also appears to show a subgenual spine on the right tibia.

Gryon nitens (Szabó)

Holotype images in MBD: Hym.Typ.No. 9630, Mus.Budapest

Sundholmia nitens Szabó, 1966: 439 (original description. Synonymized by Mineo & Caleca (1987b)).

Gryon nitens (Szabó): Mineo, 1980a: 200 (generic transfer, description); Johnson, 1992: 392 (cataloged, type information).

Comments

Most of the diagnostic characters that place this species in Gryon are visible in the holotype but the specimen is not entirely clean. In lateral view, the subgenual spines are apparent and the metapleuron is not dorsoventrally divided by a change in sculpture or setation. In dorsal view, the striation is visible in the anterior portion of the axillar crescent and the foveae along the anterior margin of T1 are uniform in size, ending sublaterally in a carina. The lateral pit on T1 is obscured. The anterolateral view of the head illustrates that the frons does not have macrosculpture.

Gryon nosulcum Kozlov & Lê

Gryon nosulcum Kozlov & Lê, 1992: 212, 221 (original description, assigned to misellum species group, keyed).

Gryon nosulcus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 128 (description, keyed, type information).

Gryon obscurum Mineo

Gryon obscurum Mineo, 1991: 27 (original description, assigned to myrmecophilum species group).

Gryon oligomerum Kononova

Gryon oligomerum Kononova: Kononova, Pavlicek & Nevo, 2005: 816 (description); Kononova, Pavlicek & Nevo, 2005: 1358 (original description); Kononova & Kozlov, 2008: 329, 406 (description, keyed).

Comments

Figures 61 and 62 in the original description illustrate the anterior head and the female antenna, both of which indicate that this species belongs in Gryon. The holotype specimen is mounted in a way that prevents observation of the lateral mesosoma (Cristina Vasiliţa, personal communication), but the presence of a complete mesopleural carina is visible on some of the paratype specimens, which have identical collection data. Also, in the paratype specimen photographed, the acetabular carina and ventral mesopleural carina do not intersect ventrally, providing another character by which this species may be separated from G. aetherium. The medial infuscation of the fore wing, illustrated in Figure 51 of the original description, is similar to that of G. fasciatum, which was described from Egypt. Because G. oligomerum was described from Israel, these species should be compared in future work.

Gryon paradigma Mineo

Gryon paradigma Mineo, 1991: 29 (original description, assigned to myrmecophilum species group).

Comments

Females of this species have 11 antennomeres. Figure 12 in the original description illustrates this and the number of antennomeres can also be counted in the images of the holotype specimen. However, in the original description Mineo (1991) stated, “Female... antenna, excluding A9-A12 brown,” indicating that he might not have been aware of this antennal character.

Gryon parafasciatum Mineo

Gryon parafasciatum Mineo, 1991: 30 (original description, assigned to myrmecophilum species group).

Gryon parkeri (Fouts)

Hadronotus parkeri Fouts, 1920: 64 (original description).

Gryon parkeri (Fouts): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (type information); Masner, 1983: 135, 167 (description, keyed); Johnson, 1992: 393 (cataloged, type information).

Gryon patroclus Mineo

Gryon patroclus Mineo, 1994: 119 (original description, assigned to myrmecophilum group).

Gryon pedestre (Nees von Esenbeck)

Syntype images in MBD: ZMUC 0002

Teleas pedestris Nees von Esenbeck, 1834: 293 (original description); Graham, 1988: 33 (publication of drawing by Westwood of Nees’s specimen, generic transfer. This change in interpretation of Teleas pedestris may negate some or all of the reported synonymies).

Platygaster apterus Nees von Esenbeck, 1834: 299 (original description); Kononova & Kozlov, 2001: 284 (junior synonym of Trimorus pedestris (Nees von Esenbeck)).

Prosacantha pedestris (Nees von Esenbeck): Thomson, 1859: 431 (description, generic transfer).

Prosacantha subtilis Thomson, 1859: 430 (original description. Synonymized by Szabó (1966)); Szabó, 1966: 46 (junior synonym of Trimorus pedestris (Nees von Esenbeck)); Johnson, 1992: 393 (type information).

Hoplogryon Subtilis (Thomson): Kieffer, 1908: 210 (generic transfer, keyed).

Hoplogryon pedestris (Nees von Esenbeck): Kieffer, 1908: 202, 212 (generic transfer, keyed).

Hoplogryon (Hoplogryon) pedestris (Nees von Esenbeck): Kieffer, 1910: 97 (subgeneric assignment); Kieffer, 1926: 183, 186, 189 (description, keyed).

Hoplogryon (Hoplogryon) subtilis (Thomson): Kieffer, 1910: 98 (subgeneric assignment); Kieffer, 1926: 186, 201 (description, keyed).

Hoplogryon Pedestris (Nees von Esenbeck): Kieffer, 1912: 114, 151 (description).

Hoplogryon subtilis (Thomson): Kieffer, 1912: 144 (description).

Hadronotellus pedester Kieffer, 1917: 341 (original description); Szabó, 1966: 423, 425 (description, type information, keyed); Hellén, 1971: 23 (description).

Hadronotus pedester (Kieffer): Kieffer, 1926: 453, 456 (generic transfer, description, keyed); Meier, 1940: 80 (description, keyed); Ryakhovskii, 1959: 81 (keyed).

Platygaster aptera Nees von Esenbeck: Kieffer, 1926: 826 (description, emendation); Vlug, 1995: 48 (cataloged).

Trimorus pedestris (Nees von Esenbeck): Szabó, 1966: 25, 46 (description, synonymy, keyed); Fabritius, 1969: 271 (description); Kozlov, 1978: 625 (description); Kononova & Kozlov, 2001: 160, 165, 284 (description, keyed, no mention of generic transfer by Graham (1988), synonymy).

Trimorus subtilis (Thomson): Sundholm, 1967: 133 (lectotype designation, generic transfer).

Gryon pedester (Kieffer): Mineo, 1979b: 96 (keyed).

Gryon pedestre (Nees von Esenbeck): Johnson, 1992: 393 (cataloged); Johnson, 1992: 394 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Buhl, 1997: 42 (description); Fabritius & Popovici, 2007: 14, 18 (description, keyed).

Gryon krygeri Buhl: Buhl, 1997: 41 (replacement name for Hadronotellus pedester Kieffer, preoccupied by Teleas pedestris Nees von Esenbeck, junior synonym of Gryon pedestre (Nees von Esenbeck)).

Gryon pisus (Nixon)

Hadronotus pisus Nixon, 1934b: 292, 297 (original description, keyed); Risbec, 1950: 592, 593, 638 (description, variation, keyed).

Hadronotus Basilewskyi Risbec, 1957: 140 (original description).

Gryon pisus (Nixon): Masner, 1965: 78 (type information, generic transfer).

Gryon basilewskyi (Risbec): Masner, 1976: 58 (generic transfer, systematic position); Johnson, 1992: 379 (cataloged, type information).

Gryon pisum (Nixon): Mineo, 1991: 32 (emendation, description, synonymy, assigned to myrmecophilum species group); Johnson, 1992: 394 (cataloged, type information).

Hadronotus basilewskyi Risbec: Mineo, 1991: 32 (junior synonym of Gryon pisum (Nixon)).

Comments

This species was named after Pisus, son of Aphraeus, a character from Greek mythology, and thus the species epithet should be treated as an appositional noun.

Gryon politum (Ashmead)

Hadronotus politus Ashmead, 1894: 229, 230 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 466 (description, keyed).

Gryon politus (Ashmead): Masner, 1976: 58 (generic transfer, type information).

Gryon politum (Ashmead): Johnson, 1992: 394 (cataloged, type information).

Comments

The original description is insufficient for placing this species, and we leave it under its current generic assignment.

Gryon prisma Mineo

Gryon prisma Mineo, 1991: 34 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 120 (distribution).

Gryon psilantere Kozlov & Lê

Gryon psilantere Kozlov & Lê, 1992: 213, 221 (original description, assigned to misellum species group, keyed).

Gryon psilanteris Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 130 (description, keyed, type information).

Gryon rectum Kozlov & Kononova

Gryon rectus Kozlov & Kononova, 1989: 80, 95 (original description, keyed); Kozlov & Kononova, 1990: 268, 297 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Fabritius & Popovici, 2007: 16, 31 (description, keyed).

Gryon rectum Kozlov & Kononova: Johnson, 1992: 395 (cataloged, type information); Kononova & Kozlov, 2008: 332, 427 (description, keyed).

Comments

The original description does not list any characters that would exclude this species from Gryon, but confident determination will require examination of the holotype.

Gryon regulare Kozlov & Kononova

Gryon regularis Kozlov & Kononova, 1989: 80, 92 (original description, keyed); Kozlov & Kononova, 1990: 268, 290 (description, keyed); Kononova & Petrov, 2002: 55 (keyed).

Gryon regulare Kozlov & Kononova: Johnson, 1992: 395 (cataloged, type information); Kononova & Kozlov, 2008: 329, 401 (description, keyed).

Comments

The original description is consistent with placement of this species in Gryon, especially the following “Cheeks from above are thinly striated longitudinally”. However, examination of the type specimen is needed.

Gryon remotum Mineo

Gryon remotum Mineo, 1991: 35 (original description, assigned to myrmecophilum species group).

Gryon rubrigaster (Szabó)

Pannongryon rubrigaster Szabó, 1966: 435, 437 (original description, keyed).

Gryon rubrigaster (Szabó): Mineo, 1979a: 261 (generic transfer, type information); Mineo & Szabó, 1979: 272 (description of male); Mineo, 1991: 36 (description, assigned to myrmecophilum species group); Johnson, 1992: 395 (cataloged, type information); Mineo & Caleca, 1994: 120 (distribution); Kononova & Kozlov, 2008: 322, 338 (description, keyed).

Gryon rubrum Kononova & Petrov

Gryon rubrum Kononova & Petrov, 2001: 1470 (original description); Kononova & Petrov, 2002: 53 (keyed); Kononova & Kozlov, 2008: 323, 346 (description, keyed).

Comments

The original description refers to the head sculpture as “fine-grained, strongly smoothed” and provides no characters that would lead us to remove it from Gryon.

Gryon rubtzovi (Ryakhovskii)

Hadronotus rubtzovi Ryakhovskii, 1959: 81 (original description).

Gryon rubtzovi (Ryakhovskii): Kozlov, 1963a: 358 (description, generic transfer, lectotype designation, keyed); Kozlov, 1963b: 667, 668 (description, keyed, generic transfer, lectotype designation); Johnson, 1992: 395 (cataloged, type information); Mineo & Caleca, 1994: 127 (junior synonym of Gryon lymantriae (Masner)); Kononova & Petrov, 2002: 55 (keyed); Kononova & Kozlov, 2008: 328, 392 (treated as valid species, description, keyed, synonymy).

Gryon rubtzovi Kozlov & Kononova, 1989: 78, 86 (original description, keyed. An objective junior synonym of Hadronotus rubtzoviRyakhovskii (1959)); Kozlov & Kononova, 1990: 266, 275 (description, keyed); Johnson, 1992: 395 (cataloged, type information); Kononova & Kozlov, 2008: 392 (implicitly synonymized with Gryon rubtzovi (Ryakhovskii)).

Gryon rufescens Kozlov & Kononova

Gryon rufescens Kozlov & Kononova, 2004: 206 (original description); Kononova & Kozlov, 2008: 328, 393 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).

Comments

Our translation of the original description, and the illustrations provided therein, are not sufficient for us to determine the generic placement of this species. Therefore, we leave it in Gryon.

Gryon simile Kozlov & Kononova

Gryon similis Kozlov & Kononova, 1989: 79, 88 (original description, keyed); Kozlov & Kononova, 1990: 267, 279 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed).

Gryon simile Kozlov & Kononova: Johnson, 1992: 396 (cataloged, type information); Kononova & Kozlov, 2008: 326, 378 (description, keyed).

Gryon solutum Kononova

Gryon solutus Kononova, 2001: 1472 (original description); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 15, 21 (description, keyed).

Gryon solutum Kononova: Kononova & Kozlov, 2008: 323, 350 (description, keyed).

Comments

We leave this species in Gryon based on the original description, “The head sculpture is fine-grained. The frontal impression is distinct, its sculpture is slightly smoothed.”

Gryon sparsum Kozlov & Kononova

Gryon sparsum Kozlov & Kononova, 2004: 207 (original description); Kononova & Kozlov, 2008: 328, 397 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).

Comments

The illustrations in the original description are consistent with placement with Gryon. We thus choose to leave it in this genus until direct examination of the holotype can occur.

Gryon spennum Kozlov & Lê

Gryon spennum Kozlov & Lê, 1992: 212, 221 (original description, assigned to misellum species group, keyed).

Gryon spennus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 131 (description, keyed, type information).

Gryon striatum (Caleca), comb. nov.

Breviscelio striatus Caleca, 1992: 49, 52 (original description, keyed).

Gryon subfasciatum (Wollaston)

Telenomus subfasciatus Wollaston, 1858: 25 (original description); Kieffer, 1926: 40 (description).

Hadronotus subfasciatus (Wollaston): Dodd, 1920a: 350 (generic transfer).

Gryon subfasciatus (Wollaston): Masner, 1965: 78 (type information, generic transfer); Mineo, 1980a: 201 (description).

Gryon subfasciatum (Wollaston): Graham, 1984: 99 (emendation); Johnson, 1992: 396 (cataloged, type information).

Comments

Neither the original description nor the redescription by Mineo (1980a) enables unambiguous generic placement. We leave this species in Gryon until the holotype specimen can be examined.

Gryon szaboi Mineo

Hadronotellus hungaricus Szabó, 1966: 422, 423 (original description, keyed).

Gryon hungaricus (Szabó): Kozlov, 1978: 619 (description, generic transfer); Mineo, 1979a: 250 (variation); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 292 (description, keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 16 (keyed).

Gryon szaboi Mineo: Mineo, 1991: 11, 12 (replacement name for Hadronotellus hungaricus Szabó, description, assigned to hungaricum species group, keyed); Mineo & Caleca, 1994: 120 (distribution).

Gryon hungaricum (Szabó): Johnson, 1992: 385 (cataloged, type information); Kozlov & Kononova, 2008: 329, 403 (description, keyed).

Comments

We leave this species in Gryon based on Mineo’s (1991) assignment of it to the hungaricum group.

Gryon szelenyii (Szabó)

Pannongryon szelenyii Szabó, 1966: 435 (original description, keyed).

Gryon szelenyii (Szabó): Kozlov, 1971: 48, 49 (diagnosis, generic transfer); Kozlov, 1978: 620 (description); Mineo & Szabó, 1978a: 93 (description); Mineo, 1980a: 196 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 288 (description, keyed); Johnson, 1992: 397 (cataloged, type information); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 26, 66 (keyed); Kononova & Kozlov, 2008: 326, 375 (description, keyed).

Pannongryon szelenyi Szabó: Mineo, 1991: 38 (misspelling).

Gryon szeleneyi (Szabó): Mineo, 1991: 38 (description, assigned to myrmecophilum species group, misspelling).

Gryon tardum Kononova & Fursov

Gryon tardus Kononova & Fursov: Kononova & Fursov, 2005a: 593 (original description); Kononova & Fursov, 2005b: 303 (description).

Gryon tardum Kononova & Fursov: Kononova & Kozlov, 2008: 330, 410 (description, keyed).

Comments

This species remains Gryon based on the original description “Frontal depression shallow, smooth, shining, with distinct longitudinal carina, almost reaching the anterior ocellus,” and Figure 14 which illustrates the presence of facial striae and a somewhat protruding clypeus.

Gryon tauricum Kozlov & Kononova

Gryon tauricus Kozlov & Kononova, 1989: 80, 93 (original description, keyed); Kononova & Petrov, 2002: 55 (keyed).

Gryon tauricum Kozlov & Kononova: Kononova & Kozlov, 2008: 329, 405 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

This species remains Gryon based on the original description.

Gryon tiliarum (Kononova & Petrov), comb. nov.

Exon tiliarum Kononova & Petrov, 2002: 57 (original description, keyed); Kononova & Kozlov, 2008: 447, 450 (description, keyed, generic transfer).

Gryon thema Mineo

Gryon thema Mineo, 1991: 38 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 120 (distribution).

Gryon tobiasi Kozlov & Kononova

Gryon tobiasi Kozlov & Kononova, 2004: 207 (original description); Kononova & Kozlov, 2008: 327, 387 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).

Gryon triangulum Masner

Holotype images in MBD: CNC No. 17018

Gryon triangulum Masner, 1983: 135, 171 (original description, keyed); Sarazin, 1986: 979 (type information); Johnson, 1992: 397 (cataloged, type information).

Gryon trjapitzini Kozlov & Kononova

Gryon trjapitzini Kozlov & Kononova, 1989: 79, 90 (original description, keyed); Kozlov & Kononova, 1990: 267, 283 (description, keyed); Johnson, 1992: 397 (cataloged, type information); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 29, 68 (keyed); Kononova & Kozlov, 2008: 327, 384 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).

Comments

This species remains in Gryon based on characters in the original description, “Frontal depression shallow, smooth, mirror-shiny. The head is fine-grained.”

Gryon turcicum Kononova & Petrov

Gryon turcicus Kononova & Petrov, 2001: 1471 (original description); Kononova & Petrov, 2002: 53 (keyed).

Gryon turcicum Kononova & Petrov: Kononova & Kozlov, 2008: 323, 347 (description, keyed).

Comments

The original description of this species is very short and states that the surface sculpture of the head and mesosoma is like that of Gryon rubrum.

Gryon ukrainicum (Kozlov & Kononova), comb. nov.

Eremioscelio ukrainica Kozlov & Kononova, 1990: 311, 314 (original description, keyed); Johnson, 1992: 373 (cataloged, type information); Fabritius & Popovici, 2007: 36, 40 (description, keyed).

Eremioscelio ukrainicus Kozlov & Kononova: Kononova & Kozlov, 2008: 452, 453 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon valeria Talamas & Timokhov, nom. n.

Eremioscelio tauricus Kozlov & Kononova, 1990: 311, 317 (original description, keyed); Johnson, 1992: 373 (cataloged, type information); Fabritius & Popovici, 2007: 36, 38 (description, keyed); Kononova & Kozlov, 2008: 452, 457 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

We transfer this species to Gryon based on its prior placement in Eremioscelio, which results in homonymy with Gryon tauricum Kozlov & Kononova (1989). We here provide a euphonic replacement name, “valeria”, to be treated as a noun in apposition.

Gryon verum Kozlov & Kononova

Gryon verus Kozlov & Kononova, 1989: 79, 91 (original description, keyed); Kozlov & Kononova, 1990: 267, 284 (description, keyed); Kononova & Petrov, 2002: 54 (keyed).

Gryon verum Kozlov & Kononova: Johnson, 1992: 398 (cataloged, type information); Kononova & Kozlov, 2008: 326, 372 (description, keyed).

Comments

The description from Kozlov & Kononova (1990) stated, “The frontal impression above the antenna is deep, the granularity of the impression is well pronounced.” No mention of transverse striae supports leaving this species in Gryon, but examination of the holotype is needed for confident placement.

Gryon xanthogaster (Ashmead)

Figures 83–87; Holotype images in MBD: USNMENT00989056

Acolus xanthogaster Ashmead, 1893: 174 (original description).

Psilacolus xanthogaster (Ashmead): Kieffer, 1910: 101 (generic transfer); Kieffer, 1926: 152, 153 (description, keyed).

Acoloides xanthogaster (Ashmead): Muesebeck & Walkley, 1951: 696 (generic transfer).

Gryon xanthogaster (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 37 (type information); Masner, 1983: 133, 163 (description, keyed); Johnson, 1992: 398 (cataloged, type information).

Comments

Masner (1983) described G. xanthogaster as having transverse ridges in the frontal depression and tridentate mandibles, characters that would place this species in Hadronotus. However, the holotype specimen does not have transverse ridges in the frontal depression (Figure 84). We identified specimens as G. xanthogaster based on their congruence with the morphology of the head and mesosoma of the holotype (Figures 83–85) and the yellow metasoma, as is referenced by the name of this species. An example of a recently collected specimen of G. xanthogaster is illustrated in Figures 86–87), which shows the striate axillula and lateral pit on T1.

We suspect that the concept of G. xanthogaster from Masner (1983) applies to Hadronotus bicolor (Figures 88–91), a species of similar size and color pattern that was originally described from the Caribbean. As was mentioned by Masner (1983), this species is somewhat common in Florida, although we have recorded specimens from Washington, DC.

Figures 83–87. 

Gryon xanthogaster 83 holotype female (USNMENT00989056), head and mesosoma, lateral view 84 holotype female (USNMENT00989056), head, anterior view 85 holotype female (USNMENT00989056), head and mesosoma, dorsal view 86 female (UCFC 026 738), head and mesosoma lateral view 87 female (UCFC 026 738), habitus, dorsolateral view.

Hadronotus Förster

Hadronotus Förster, 1856 stat. rev.: 101, 105 (original description. Type: Hadronotus exsculptus Förster, first included species, keyed. Synonymized by Nixon (1936), Masner (1961)); Walker, 1874: 10 (keyed); Howard, 1886: 172 (keyed); Cresson, 1887: 248, 314 (catalog of species of U.S. and Canada); Cresson, 1887: 84 (keyed); Ashmead, 1893: 210, 211, 229 (description, keyed, key to species of U.S. and Canada); Ashmead, 1894: 217, 229 (key to species of St. Vincent, keyed); Ashmead, 1896: 265 (keyed); Dalla Torre, 1898: 498 (catalog of species); Ashmead, 1900: 328 (list of species of West Indies); Ashmead, 1903: 92, 94 (keyed); Kieffer, 1908: 119 (keyed); Brues, 1908: 27, 28, 37, 51 (diagnosis, list of species, keyed); Kieffer, 1910: 65, 81 (description, list of species, keyed); Brues, 1910: 47 (key to species of North America); Kieffer, 1912: 56 (key to species of Seychelles); Dodd, 1913a: 131 (keyed); Kieffer, 1913: 230, 235 (description, key to species of Europe and Algeria); Dodd, 1915: 18 (key to species of Australia, Java, and Fiji); Brues, 1916: 543, 544 (keyed); Kieffer, 1926: 271, 453 (description, keyed, key to species); Nixon, 1934: 1 (description, key to new species described); Nixon, 1934: 290 (description, key to species of Africa); Jansson, 1939: 172 (keyed); Maneval, 1940: 112, 113 (keyed); Mani, 1941: 20, 26 (catalog of species of India, keyed); Risbec, 1950: 585, 591 (key to species of Ethiopian region, keyed); Muesebeck & Walkley, 1951: 704 (catalog of species of U.S. and Canada); Muesebeck & Walkley, 1956: 357 (citation of type species); Masner, 1958: 42 (status of subgenera, delimitation of species groups); Masner, 1961: 158 (junior synonym of Gryon Haliday); Szabó, 1966: 421, 429 (description, key to Palearctic species known to the author, keyed); Baltazar, 1966: 182 (cataloged, catalog of species of the Philippines); Hellén, 1971: 5, 22 (description, keyed); Carpenter, 1992: 471 (fossil references). Comments. The holotype specimen of Hadronotus exsculptus is missing its head (Figures 92–94), but the morphology of the mesosoma and metasoma clearly match the generic concept that we associate with Clade B: T1 without lateral pit (Figure 93), hind tibia without subgenual spines (Figure 94), metapleuron setose (Figure 94). The nearly parallel arrangement of the acetabular carina and mesopleural carina, and transverse shape of foveae in the prespecular sulcus are characters known to us from other species of Hadronotus and will be useful for treating H. exsculptus at the species level in future studies.

Muscidea Motschoulsky, 1863 syn. n.: 70 (original description. Type: Muscidea pubescens Motschoulsky, by monotypy. Synonymized by Masner (1976)); Ashmead, 1904a: 326 (keyed); Masner, 1976: 57 (junior synonym of Gryon Haliday).

Hadronotoides Dodd, 1913b syn. n.: 171 (original description. Type: Hadronotus pentatomus Dodd, by monotypy and original designation. Treated as junior synonym of Gryon by Caleca (1990)); Kieffer, 1926: 266, 474 (description, keyed, key to species); Brues, 1940: 81 (description); Mani, 1941: 19, 27 (catalog of species of India, keyed); Muesebeck & Walkley, 1956: 357 (citation of type species); Masner, 1976: 7, 59 (description, keyed); Mani & Sharma, 1982: 151 (keyed); Mineo & Villa, 1982b: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 139 (taxonomic value of structures on the posterior surface of the head); Galloway & Austin, 1984: 6, 81 (diagnosis, list of species described from Australia, keyed); Johnson, 1992: 398 (cataloged, catalog of world species); Carpenter, 1992: 471 (fossil references).

Platyteleia Dodd, 1913a syn. n.: 131, 153 (original description. Type: Platyteleia latipennis Dodd, by monotypy and original designation); Dodd, 1914b: 79 (description); Kieffer, 1926: 269, 408 (description, keyed, key to species); Muesebeck & Walkley, 1956: 386 (citation of type species); Masner, 1958: 42 (status of subgenera, delimitation of species groups); Masner, 1961: 158 (junior synonym of Gryon Haliday); Szabó, 1966: 421, 429 (description, key to Palearctic species known to the author, keyed); Baltazar, 1966: 182 (cataloged, catalog of species of the Philippines); Hellén, 1971: 5, 22 (description, keyed); Galloway & Austin, 1984: 78 (junior synonym of Gryon Haliday); Carpenter, 1992: 471 (fossil references).

Telenomoides Dodd, 1913a syn. n. : 158, 168 (original description. Type: Telenomoides flavipes Dodd, by original designation. Key to species of Australia, keyed); Muesebeck & Walkley, 1956: 402 (citation of type species). Comments.Mineo (1990a) treated Telenomoides flavipes as a junior synonym of Gryon orestes (Dodd), implicitly making Telenomoides a junior synonym of Gryon. Examination of the holotype specimen leads us to treat Telenomoides as a junior synonym of Hadronotus based on the presence of five clavomeres, the shape of the clypeus, and the form of foveae along anterior T1.

Notilena Brèthes, 1913 syn. n.: 84 (original description. Type: Notilena Gallardoi Brèthes, by monotypy and original designation); Muesebeck & Walkley, 1956: 375 (citation of type species); De Santis & Esquivel, 1966: 96 (junior synonym of Gryon Haliday). Comments. We remove Notilena from Gryon and treat it as a synonym of Hadronotus based on characters in the original description, “Capite punctato-umbilicato, facie longitrorsum impressa, utrinque transverse striata et in medio antennas versus longitrorsum cristata,” which we interpret to indicate that the sculpture of the head is punctate-umbilicate and that the antennal scrobe has transverse striation.

Austroscelio Dodd, 1914c syn. n.: 93 (original description. Type: Sparasion nigricoxa Dodd, by original designation. Synonymized by Galloway, in Galloway & Austin (1984)); Kieffer, 1926: 266, 473 (description, keyed, key to species); Muesebeck & Walkley, 1956: 334 (citation of type species); Galloway & Austin, 1984: 78 (junior synonym of Gryon Haliday).

Hadrophanurus Kieffer, 1926 syn. n.: 15, 130 (original description. Type: Telenomus pennsylvanicus Ashmead, by monotypy, keyed. Synonymized by Masner (1961)); Muesebeck & Walkley, 1951: 694 (catalog of species of U.S. and Canada); Muesebeck & Walkley, 1956: 357 (citation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday); Subba Rao & Chacko, 1962: 479 (key to species).

Diagnosis

Sculpture of head and mesosoma highly variable, ranging from coriaceous microsculpture to coarsely areolate or rugose; mandibular dentition variable, teeth of unequal size; clypeus not projecting; ventral frons without facial striae; antennal scrobe with macrosculpture ranging from transversely striate to areolate rugose; antennal scrobe often delimited by carinae; female antenna with 10 flagellomeres, four to seven clavomeres; sculpture of mesoscutum and mesoscutellum variable, ranging from coriaceous microsculpture to coarsely areolate, striate or rugose; epomial carina variable, sometimes extending dorsally to pronotal shoulder; netrion absent; mesoscutal humeral sulcus and mesoscutal suprahumeral sulcus variable: absent or indicated by a furrow or line of foveae; mesoscutum with or without humeral pit; sculpture of axillula variable, sometimes with parallel carina between coarse foveae, but not distinctly striate; metapleuron divided dorsoventrally by a change in sculpture or setation; hind tibia without subgenual spines; foveae along anterior T1 decreasing in size laterally, not bordered laterally by a carina or pit.

Comments. Hadronotus is morphologically variable and to our knowledge is not united by any single character.

Species of Hadronotus

Hadronotus achille (Mineo), comb. nov.

Gryon achille Mineo, 1992: 25 (original description).

Hadronotus aculeator (Masner), comb. nov.

Holotype images in MBD: USNMENT01059225

Gryon aculeator Masner, 1983: 157 (original description); Johnson, 1992: 378 (cataloged, type information).

Hadronotus aculus (Mineo), comb. nov.

Gryon aculum Mineo, 1991: 2 (original description, assigned to aculum species group).

Hadronotus acuteangulatus (Mineo), comb. nov.

Gryon acuteangulatum Mineo, 1991: 3 (original description, assigned to acuteangulatum species group).

Comments

We transfer this species based the paratype specimen that we examined as well as characters and Figures 1a–b from the original description, “clava of six antennomeres... the sculpture of the head consists of irregular polygons.”

Hadronotus acutiventris (Masner), comb. nov.

Holotype images in MBD: CNC No. 17015

Gryon acutiventre Masner, 1983: 134, 158 (original description, keyed); Johnson, 1992: 378 (cataloged, type information).

Hadronotus agamennone (Mineo), comb. nov.

Gryon agamennone Mineo, 1992: 26 (original description)

Comments

We transfer this species based on a paratype specimen and the original description, “...frontal depression that is striated for not more than ⅔, the remaining being smooth and shiny,” and because it was considered by Mineo 1992 to be part of the oculatum species group.

Hadronotus agilis Ashmead, comb. rev.

Hadronotus agilis Ashmead, 1896: 799 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 466 (description, keyed).

Gryon agilis (Ashmead): Masner, 1965: 74 (type information, generic transfer); Masner, 1976: 58 (description).

Gryon agile (Ashmead): Johnson, 1992: 378 (cataloged, type information).

Comments

We transfer this species back to Hadronotus based on the original description of the sculpture as “coarsely rugose.”

Hadronotus alames (Kozlov & Lê), comb. nov.

Holotype images in MBD: IEBR 0160

Gryon alames Kozlov & Lê, 1992: 233, 237 (original description, assigned to muscaeforme species group, keyed); Kozlov & Lê, 1996: 12 (description); Lê, 2000: 100 (description, keyed, type information).

Hadronotus allanidoddi (Mineo), comb. nov.

Plastogryon flavipes Dodd, 1914a: 125 (original description. Preoccupied by Telenomoides flavipesDodd (1913a)); Dodd, 1915: 25 (keyed).

Plastogryon (Heterogryon) flavipes Dodd: Kieffer, 1926: 446, 451 (description, subgeneric assignment, keyed).

Gryon flavipes (Dodd): Galloway, 1976: 91 (type information, generic transfer); Johnson, 1992: 383 (cataloged, type information).

Gryon allanidoddi Mineo: Mineo, 1990b: 55 (replacement name for Plastogryon flavipes Dodd, description).

Hadronotus ambericus (Peter & Rajmohana), comb. nov.

Gryon ambericum Peter & Rajmohana, 2014: 6711 (original description, diagnosis, placed in leptocorisae species group).

Comments

Our transfer of this species to Hadronotus is based on images provided in the original description.

Hadronotus amerares (Kozlov & Lê), comb. nov.

Holotype images in MBD: IEBR 0161

Gryon amerares Kozlov & Lê, 1992: 230, 237 (original description, assigned to muscaeforme species group, keyed).

Gryon ameraris Kozlov & Lê, 1996: 11 (description); Lê, 2000: 99, 101 (description, keyed, type information).

Hadronotus americanus (Mineo), comb. nov.

Gryon americanum Mineo, Mineo & Caleca,1994: 130 (original description)

Comments

We transfer this species based on the original description, “frontal depression deep and large, crossed by dense and parallel transverse striae.”

Hadronotus amissus (Kozlov & Kononova), comb. nov.

Gryon amissus Kozlov & Kononova, 1989: 87 (original description, keyed); Kozlov & Kononova, 1989: 266, 276 (description, keyed).

Gryon amissum Kozlov & Kononova: Kononova & Kozlov, 2008: 324, 351 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

We transfer this species based on the original description, “Frontal depression above antennae well pronounced, transversely striated.”

Hadronotus amitto (Kozlov & Kononova), comb. nov.

Gryon amitto Kozlov & Kononova, 1989: 87 (original description, keyed).

Comments

We transfer this species based on the original description, “Frontal depression above antennae well pronounced, transversely striated.”

Hadronotus anasae (Ashmead), comb. rev.

Holotype images in MBD: USNMENT00979994

Telenomus anasae Ashmead, 1887: 23 (original description).

Hadronotus rugosus Howard, 1889: 242 (original description. Synonymized by Masner (1983)); Ashmead, 1893: 230, 232 (description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 463 (description, keyed); Masner, 1983: 139 (junior synonym of Gryon anasae (Ashmead)); Johnson, 1992: 378 (type information).

Hadronotus anasae (Ashmead): Ashmead, 1893: 231, 233 (generic transfer, description, keyed); Brues, 1910: 47 (keyed); Brues, 1916: 555 (description); Kieffer, 1926: 454, 464 (description, keyed).

Gryon anasae (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (lectotype designation); Masner, 1983: 134, 139 (description, synonymy, keyed); Mineo & Caleca, 1987a: 32 (description); Johnson, 1992: 378 (cataloged, type information).

Gryon rugosus (Howard): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (lectotype designation).

Gryon rugosum (Howard): Mineo & Caleca, 1987a: 34 (description).

Hadronotus ancinla (Kozlov & Lê), comb. nov.

Gryon ancinla Kozlov & Lê, 1992: 236, 238 (original description, assigned to muscaeforme species group, keyed); Kozlov & Lê, 1996: 11 (description); Lê, 2000: 98, 102 (description, keyed, type information).

Gryon clavaerum Kozlov & Lê, 1992: 233, 237 (original description, assigned to muscaeforme species group, keyed).

Gryon clavaerus Kozlov & Lê, 1996: 12 (description); Lê, 2000: 99, 108 (description, keyed, type information); Chen et al., 2020: 12 (junior synonym of Gryon ancinla Kozlov & Lê)

Hadronotus anserculus (Mineo), comb. nov.

Gryon anserculum Mineo, 1991: 7 (original description, assigned to aureum species group).

Hadronotus apex (Kozlov & Kononova), comb. nov.

Gryon apex Kozlov & Kononova, 2004: 195 (original description); Kononova & Kozlov, 2008: 324, 358 (description, keyed).

Hadronotus argus (Kononova), comb. nov.

Gryon argus Kononova, 2005: 1353 (original description)

Comments

From the original description, “The frontal indentation is superficial, not bordered by an arcuate keel, in transverse wrinkles, with a distinct longitudinal keel.” The summary of the original publication, written in English, states that “Gryon argus is similar to G. coronatum, Kononova, but differs in abdomen proportions.” Illustrations in the original description of G. coronotum depict a frontal depression that enables us to place that species in Hadronotus. It is on this basis and the presence of “transverse wrinkles” in the frontal depression that we make the generic transfer.

Hadronotus artus (Kozlov & Kononova), comb. nov.

Gryon artus Kozlov & Kononova, 1989; 81, 99 (original description); Kozlov & Kononova, 1990: 306 (description, keyed); Johnson, 1992: 379 (catalogued); Kononova & Kozlov, 2008: 333, 439 (description, keyed).

Comments

Mirotelenomus artus Kozlov was transferred to Exon by Masner (1980) and to Gryon by Mineo (1980a). The description of Gryon artus Kozlov & Kononova thereby created a homonym, one that is resolved by our transfer of this species to Hadronotus.

Hadronotus atrocoxalis Ashmead, comb. rev.

Hadronotus atrocoxalis Ashmead, 1896: 799 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 466 (description, keyed).

Gryon atrocoxalis (Ashmead): Masner, 1965: 74 (type information); Masner, 1976: 58 (description, systematic position); Masner, 1979: 792, 794 (description, keyed).

Gryon atrocoxale (Ashmead): Johnson, 1992: 379 (cataloged, type information).

Comments

The original description indicates that this species is rugose, and separately states “Abdomen rugose”, leading us to believe that the former refers to the head or mesosoma. Masner (1976) commented that it “runs to floridanus-Ashmead group yet of much finer sculpture” and Masner (1979) placed this species in the variicornis species group, which we consider to belong in Hadronotus.

Hadronotus ater (Masner), comb. nov.

Figure 11: Holotype images in MBD: CNC No. 17012

Gryon atrum Masner, 1983: 135, 139 (original description, keyed); Sarazin, 1986: 972 (type information); Johnson, 1992: 379 (cataloged, type information).

Hadronotus aureus (Dodd), comb. nov.

Plastogryon aureus Dodd, 1914f: 256 (original description); Dodd, 1915: 24 (keyed).

Plastogryon (Heterogryon) aureus Dodd: Kieffer, 1926: 447, 450 (description, subgeneric assignment, keyed).

Gryon aureus (Dodd): Galloway, 1976: 91 (type information, generic transfer).

Gryon aureum (Dodd): Mineo, 1991: 7 (assigned to aureum species group); Johnson, 1992: 379 (cataloged, type information).

Comments

The original description is insufficient to determine if this species belongs in Gryon or Hadronotus. Mineo (1991) assigned Gryon aureum to an eponymous species group but without explicitly stating if the holotype specimen of Plastogryon aureus was examined. The characters in the description of the aureum species group indicate that it belongs in Hadronotus and it is on this basis that we transfer it.

Hadronotus austini (Mineo), comb. nov.

Gryon austini Mineo, 1991: 6 (original description, assigned to acuteangulatum species group).

Comments

The transfer to Hadronotus is based on examination of a paratype specimen and characters in the original description: mandibles tridentate, striae present above the frontal depression, and frons sculptured with irregular polygons.

Hadronotus australicus (Mineo), comb. nov.

Sparasion nigricoxa Dodd, 1914a: 123 (original description. Preoccupied by Gryon nigricoxa (Dodd) (1913a)).

Austroscelio nigricoxa (Dodd): Dodd, 1914c: 93 (description, generic transfer, synonymy); Kieffer, 1926: 473 (description, keyed); Galloway, 1976: 85 (type information).

Sparaison australicum Dodd, 1914f: 255 (original description, spelling error. Synonymized by Dodd (1914c)); Johnson, 1992: 391 (type information).

Sparasion australicum Dodd: Dodd, 1914c: 93 (junior synonym of Austroscelio nigricoxa (Dodd)).

Sparasion australicus Dodd: Kieffer, 1926: 299 (description, emendation).

Austroscelio australicum (Dodd): Galloway, 1976: 85 (type information).

Gryon nigricoxa (Dodd): Galloway & Austin, 1984: 80 (generic transfer); Johnson, 1992: 391 (cataloged, type information).

Gryon australicum Mineo: Mineo, 1990b: 52 (replacement name for Sparasion nigricoxa Dodd, assigned to insulare species group, type information).

Hadronotus avanus (Kozlov & Lê), comb. nov.

Paratype Images in MBD: USNMENT01223638

Gryon avanum Kozlov & Lê, 1992: 231, 237 (original description, assigned to muscaeforme species group, keyed).

Gryon avanus Kozlov & Lê, 1996: 12 (description); Lê, 2000: 99, 103 (description, keyed, type information).

Hadronotus baeiformis (Marshall), comb. rev.

Prosacantha baeiformis Marshall, 1892: 75 (original description).

Hoplogryon (Hoplogryon) baeiformis (Marshall): Kieffer, 1910: 96 (generic transfer, subgeneric assignment).

Hadronotus baeiformis (Marshall): Kieffer, 1926: 455, 468 (generic transfer, description, keyed).

Gryon baeiforme (Marshall): Johnson, 1992: 379 (cataloged).

Comments

The original description states that the head is “partout fortement ponctuée” which translates to “strongly punctuated everywhere” and is the basis for transferring this species to Hadronotus.

Hadronotus barbiellinii Costa Lima, comb. rev.

Hadronotus Barbiellinii Costa Lima, 1940: 65 (original description).

Gryon barbiellinii (Costa Lima): De Santis, 1980: 312 (generic transfer); Johnson, 1992: 379 (cataloged, type information).

Comments

This species is returned to Hadronotus based on characters in the original description, “Face (frontal space located above the base of the antennae and inside the curved protruding line that separates it from the forehead) presenting, in the middle, deep longitudinal groove, transversely striated, at the sides of which there is an oblique series of 4 to 5 relatively wide areolas, immediately into the small areolas that border the edge of the eye and out of another series of areolas, much smaller, which are parallel to it.”

Hadronotus basokoi Risbec, comb. rev.

Hadronotus basokoi Risbec, 1958: 115 (original description).

Gryon basokoi (Risbec): Masner, 1976: 58 (generic transfer, systematic position); Johnson, 1992: 379 (cataloged, type information).

Comments

From the original description, “Quite deep postantennal depressions, clearly limited by two ridges which meet at a sharp angle. Crossed by fairly strong streaks.”

Hadronotus bicolor Ashmead, comb. rev.

Hadronotus bicolor Ashmead, 1894: 229, 231 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 468 (description, keyed).

Gryon bicolor (Ashmead): Masner, 1976: 58 (generic transfer, taxonomic status); Mineo, 1980a: 190 (removed from synonymy with Gryon misellum Haliday); Johnson, 1992: 379 (cataloged).

Hadronotus bimaculatus (Mineo), comb. nov.

Gryon bimaculatum Mineo, 1983c: 546, 551 (original description); Johnson, 1992: 380 (cataloged, type information).

Hadronotus bini (Mineo), comb. nov.

Gryon bini Mineo, 1983c: 528, 546 (original description); Johnson, 1992: 380 (cataloged).

Hadronotus blaches (Kozlov & Lê), comb. nov.

Holotype images in MBD: IEBR 0048

Gryon blaches Kozlov & Lê, 1992: 225, 227 (original description, assigned to insulare species group, keyed).

Gryon blachis Kozlov & Lê, 1996: 10 (description); Lê, 2000: 98, 104 (description, keyed, type information).

Hadronotus bolivari Giard, comb. rev.

Hadronotus Bolivari Giard, 1895: 78 (original description. Type lost from MNHN); Kieffer, 1913: 244 (description).

Hadronotus Proximus Kieffer, 1913: 244 (original description); Johnson, 1992: 380 (type information).

Hadronotus bolivari Giard: Kieffer, 1926: 454, 458 (description, keyed); Szabó, 1966: 430, 433 (description, keyed).

Hadronotus proximus Kieffer: Kieffer, 1926: 454, 459 (description, keyed); Bin, 1974: 455 (type misssing from MCSN); Mineo, 1979a: 237 (lectotype designation).

Hadronotus ochraceus Szabó, 1966: 429, 431 (original description); Mineo, 1979a: 237 (junior synonym of Hadronotus Bolivari Giard); Johnson, 1992: 380 (type information).

Gryon proximus (Kieffer): Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 280 (description, keyed); Kononova & Petrov, 2002: 54 (keyed).

Gryon bolivari (Giard): Mineo, 1979: 237 (description, generic transfer); Mineo, 1981: 119, 120 (description, type information, keyed); Johnson, 1992: 380 (cataloged, type information); Mineo & Caleca, 1994: 117 (distribution, assigned to muscaeforme subgroup of muscaeforme group); Kononova & Kozlov, 2008: 325, 362 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

We return this species to Hadronotus based on a character in the original description, “head black, punctate.”

Hadronotus bosellii (Mineo & Szabó), comb. nov.

Gryon bosellii Mineo & Szabó, 1978b: 113 (original description); Mineo, 1981a: 119, 124 (diagnosis, keyed); Johnson, 1992: 380 (cataloged, type information); Mineo & Caleca, 1994: 117 (distribution, assigned to muscaeforme subgroup of muscaeforme group); Kononova & Petrov, 2002: 54 (keyed); Kononova & Kozlov, 2008: 325, 367 (description, keyed).

Hadronotus brasiliensis Costa Lima, comb. rev.

Hadronotus brasiliensis Costa Lima, 1928: 1 (original description).

Gryon brasiliensis (Costa Lima): De Santis, 1980: 312 (generic transfer).

Gryon brasiliense (Costa Lima): Johnson, 1992: 380 (cataloged, type information).

Comments

We transfer this species back to Hadronotus based on characters in the original description, “antennal suture or pit distinctly separated from the forehead by an arched cross-striated trench, leading the most saline striae of the midline to the areolas of the face.”

Hadronotus cabrucae (Mineo), comb. nov.

Gryon cabrucae Mineo, Mineo & Caleca, 1994: 126 (original description, assigned to floridanum group).

Hadronotus canus (Mineo), comb. nov.

Gryon canum Mineo, 1991: 15 (original description, assigned to leptocorisae species group); Mineo & Caleca, 1994: 122 (distribution).

Hadronotus carinatifrons Ashmead, comb. rev.

Hadronotus carinatifrons Ashmead, 1894: 229, 230 (original description); Ashmead, 1900: 328 (distribution); Brues, 1910: 47 (keyed); Kieffer, 1926: 455, 467 (description, keyed).

Gryon carinatifrons (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Alayo Dalmau, 1973: 99 (cataloged); Masner, 1983: 134, 143 (type information, spelling error); Mineo & Caleca, 1987a: 32 (description, keyed); Johnson, 1992: 380 (cataloged, type information).

Gryon carinatiforns (Ashmead): Masner, 1976: 58 (type information, spelling error).

Hadronotus charon Nixon, comb. rev.

Hadronotus charon Nixon: Nixon, 1934b: 292, 306 (description); Risbec, 1950: 592, 595 (original description).

Gryon charon (Nixon): Masner, 1965: 75 (type information); Mineo, 1982b: 312 (description); Mineo, 1983a: 18 (description, variation, keyed); Johnson, 1992: 380 (cataloged, type information).

Hadronotus chelinideae (Masner), comb. nov.

Holotype images in MBD: USNMENT01059234

Gryon chelinideae Masner, 1983: 133, 159 (original description, keyed); Johnson, 1992: 381 (cataloged, type information).

Hadronotus chinchillae (Caleca), comb. nov.

Gryon chinchillae Caleca, 1990a: 119, 120 (original description, keyed).

Hadronotus circus (Kozlov & Lê), comb. nov.

Paratype images in MDB: USNMENT01223669

Gryon circum Kozlov & Lê, 1992: 223, 227 (original description, assigned to insulare species group, keyed).

Gryon circus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 107 (description, keyed, type information).

Comments

The frons of this species suggests close relation to H. watshami.

Hadronotus clavigrallae (Mineo), comb. nov.

Gryon clavigrallae Mineo, Mineo & Caleca, 1994: 116 (original description, assigned to fulviventre subgroup of muscaeforme group).

Hadronotus compoventris (Kozlov & Lê), comb. nov.

Holotype images in MBD: IEBR 0163

Gryon compoventre Kozlov & Lê, 1992: (original description, assigned to muscaeforme species group, keyed).

Gryon compoventris Kozlov & Lê, 1996: 11 (description); Lê, 2000: 99, 110 (description, keyed, type information).

Hadronotus coronatus (Kononova), comb. nov.

Gryon coronatum Kononova, 2008: 322, 335 (original description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Comments

In the original description, figure 176 illustrates transverse striation across the frontal depression and a female antenna with five clavomeres.

Hadronotus cous Nixon, comb. rev.

Hadronotus cous Nixon, 1934b: 292, 301 (original description, keyed); Risbec, 1950: 592 (keyed).

Gryon cous (Nixon): Masner, 1965: 75 (type information).

Gryon coum (Nixon): Mineo, 1983c: 528, 546 (description, keyed); Johnson, 1992: 381 (cataloged, type information).

Comments

The original description provides characters that enable us to transfer this species to Hadronotus, including “Frons with a deep, well-defined impression which is completely margined.”

Hadronotus chromion (Kozlov & Lê), comb. nov.

Holotype images in MBD: IEBR 0175

Gryon chromion Kozlov & Lê, 1992: 232, 237 (original description, assigned to muscaeforme species group, keyed).

Gryon cromion Kozlov & Lê, 1996: 12 (description, misspelling); Lê, 2000: 100, 112 (description, keyed, type information).

Hadronotus cultratus (Masner), comb. nov.

Gryon cultratus Masner, 1979: 794, 799 (original description, keyed); Sarazin, 1986: 974 (type information).

Gryon cultratum Masner: Johnson, 1992: 381 (cataloged, type information).

Comments

This species is transferred to Hadronotus based on its placement in the variicorne group and characters presented in the original description: “head... with coarse transverse polygons”, “scutellum with polygons roughly rounded” and examination of a paratype specimen.

Hadronotus dasyni Nixon, comb. rev.

Hadronotus dasyni Nixon, 1934a: 2 (original description, keyed).

Gryon dasyni (Nixon): Masner, 1965: 75 (type information); Mineo, 1990: 90 (keyed); Johnson, 1992: 381 (cataloged, type information).

Comments

The original description and (Figure 1) in Nixon (1934) list and illustrate a form of the frontal depression that clearly places this species in Hadronotus, “Frontal impression completely margined by a sharply defined ridge.”

Hadronotus david (Masner), comb. nov.

Gryon david Masner, 1979: 793, 798 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 381 (cataloged, type information).

Hadronotus dessarti (Mineo), comb. nov.

Gryon dessarti Mineo, 1991: 38 (original description, assigned to oculatum species group).

Hadronotus diadematis (Mineo), comb. nov.

Gryon diadematis Mineo, 1983a: 18, 19 (original description, keyed); Johnson, 1992: 381 (cataloged, type information).

Comments

We transfer this species to Hadronotus based on the description of the “completely enframed frontal depression... connected to the anterior ocellus by a ridge” provided in Mineo (1983a) and examination of a paratype specimen.

Hadronotus dichromos (Galloway), comb. nov.

Plastogryon bicolo r Dodd, 1913b: 171 (original description. Preoccupied by Hadronotus bicolorAshmead (1894)); Dodd, 1915: 24 (keyed).

Plastogryon (Heterogryon) bicolor (Dodd): Kieffer, 1926: 447, 451 (description, subgeneric assignment, keyed).

Gryon bicolor (Dodd): Galloway, 1976: 91 (type information, generic transfer).

Gryon dichromos Galloway: Galloway & Austin, 1984: 79 (replacement name); Mineo, 1990a: 186 (description of male); Mineo, 1991: 7 (assigned to charon species group); Johnson, 1992: 381 (cataloged, type information).

Hadronotus discolor (Mineo & Szabó), comb. nov.

Gryon discolor Mineo & Szabó, 1978c: 94 (original description); Johnson, 1992: 382 (cataloged, type information).

Hadronotus drunores (Kozlov & Lê), comb. nov.

Holotype images in MBD: IEBR 0176

Gryon drunores Kozlov & Lê, 1992: 235 (original description, assigned to muscaeforme species group).

Gryon drumores Kozlov & Lê, 1992: 237 (keyed, misspelling).

Gryon drunoris Kozlov & Lê, 1996: 11 (description); Lê, 2000: 98, 113 (description, keyed, type information).

Hadronotus dubius (Kozlov & Kononova), comb. nov.

Gryon dubium Kozlov & Kononova, 2004: 199 (original description); Kononova & Kozlov, 2008: 322, 333 (description, keyed); Timokhov, 2019a: 19 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).

Hadronotus elegans (Dodd), comb. nov.

Plastogryon elegans Dodd, 1914c: 94 (original description); Galloway, 1976: 111 (type information, status uncertain).

Plastogryon (Heterogryon) elegans Dodd: Kieffer, 1926: 447, 451 (description, subgeneric assignment, keyed).

Gryon elegans (Dodd): Mineo, 1990a: 185 (generic transfer, type information); Mineo, 1991: 7 (assigned to aureum species group); Johnson, 1992: 382 (cataloged, type information).

Comments

Mineo (1990a) stated that he found and examined the holotype specimen of Plastogryon elegans in the South Australia Museum. Mineo (1991) placed this species in the aureum species group, which he described as having “mandibles subtridentate” and “frontal depression large but moderately deep, crossed by very fine and dense striae.” This forms our basis for transferring this species to Hadronotus.

Hadronotus elongatus Risbec, comb. rev.

Hadronotus antestiae var. elongatus Risbec, 1950: 597 (original description); Mineo, 1990b: 50 (lectotype designation, synonymy); Johnson, 1992: 383 (type information).

Gryon antestiae var. elongatus (Risbec): Masner, 1976: 58 (generic transfer, type information).

Gryon risbeci Mineo, 1990b: 50 (original description, assigned to hiberus species group, a junior objective synonym of Hadronotus antestiae var. elongatus Risbec).

Hadronotus euclidis (Mineo), comb. nov.

Gryon euclide Mineo, 1992: 21 (original description).

Hadronotus eugeniae (Risbec), comb. nov.

Microphanurus eugeniae Risbec, 1953: 326 (original description).

Gryon eugeniae (Risbec): Masner, 1976: 58 (generic transfer, type information); Johnson, 1992: 382 (cataloged, type information).

Hadronotus eurystenis (Mineo), comb. nov.

Gryon eurystene Mineo, 1992: 21 (original description)

Comments

Our transfer of this species to Hadronotus is based on the original description, which states that this species is “Closely related to G. canum” and examination of a paratype specimen

Hadronotus exsculptus Förster, comb. rev.

Hadronotus exsculptus Förster, 1861: 41 (original description); Dalla Torre, 1885: 76 (reprint of Förster (1861)); Kieffer, 1908: 145 (French translation of Förster (1861)); Kieffer, 1926: 453, 458 (description, keyed).

Hadronotus Exsculptus Förster: Kieffer, 1913: 238 (description).

Gryon exsculptus (Förster): Kozlov, 1978: 620 (description); Mineo, 1979a: 244 (description); Kozlov & Kononova, 1989: 78 (keyed).

Gryon exsculptum (Förster): Mineo, 1981a: 119, 126 (description of male, diagnosis, keyed); Johnson, 1992: 382 (cataloged, type information); Kononova & Kozlov, 2008: 325, 364 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).

Gryon exculptus (Förster): Kozlov & Kononova, 1990: 266, 272 (description, keyed, error); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 54 (keyed).

Gryon exculptum (Förster): Mineo & Caleca, 1994: 117 (spelling error, distribution, assigned to muscaeforme subgroup of muscaeforme group).

Hadronotus fervidus (Mineo), comb. nov.

Gryon fervidum Mineo, 1992: 18 (original description).

Comments

The original description is brief, and characters needed to properly place this species are largely absent. We interpret “from upper margin of the frontal depression and because there is no ridge connecting the latter to anterior ocellus” to refer to a carinate margin of the frontal depression, as is seen in Hadronotus ancinla (Chen et al. 2020), and which may be connected to the anterior ocellus by a carina. Mineo (1992) placed G. fervidum in the hiberus group, but the description of the hiberus group by Mineo (1990b) is also brief and insufficient for generic placement. We examined the holotype of Hadronotus lucmon, described as Gryon lucmon concomitantly with G. fervidum, which was also placed in the hiberus group and which belongs in Hadronotus. Our examination of a paratype specimen also supports placement of this species in Hadronotus.

Figures 88–91. 

Hadronotus bicolor 88 holotype female (USNMENT01109345), head and mesosoma, lateral view 89 holotype female (USNMENT01109345), head, anterodorsal view 90 holotype female (USNMENT01109345), habitus, dorsal view 91 female (FSCA 00091193), dorsolateral view.

Figures 92–94. 

Hadronotus exsculptus, holotype female (NHMW-HYM #0002996), mesosoma and metasoma 92 posterodorsal view 93 dorsal view 94 lateral view.

Hadronotus flavios (Dodd), comb. nov.

Plastogryon flavios Dodd, 1915: 32 (original description).

Gryon flavios (Dodd): Galloway, 1976: 91 (type information, generic transfer); Mineo, 1991: 7 (assigned to charon species group); Johnson, 1992: 382 (cataloged, type information).

Hadronotus flavipes Ashmead, comb. rev.

Holotype images in MBD: USNMENT00989868

Hadronotus flavipes Ashmead, 1905: 399 (original description. Preoccupied by Gryon flavipesAshmead (1893). Synonymized with Telenomus orestes Dodd by Mineo (1990a)); Kieffer, 1926: 454, 460 (description, keyed); Baltazar, 1966: 182 (cataloged, type information, distribution); Mineo, 1990a: 178 (junior synonym of Gryon orestes (Dodd)); Johnson, 1992: 392 (type information).

Plastogryon fuscus Dodd, 1915: 25, 26 (original description, keyed. Synonymized with Telenomus orestes Dodd by Mineo (1990a)); Mineo, 1990a: 178 (junior synonym of Gryon orestes (Dodd)); Johnson, 1992: 392 (type information).

Telenomus orestes Dodd, 1913a: 167, 168 (original description, keyed).

Liophanurus orestes (Dodd): Kieffer, 1926: 68, 90 (description, generic transfer, keyed).

Hadronotus leptocorisae Nixon, 1934: 2, 5 (original description, keyed. Preoccupied by Hadronotus leptocorisae Howard (1885). Synonymized with Hadronotus flavipes Ashmead by Mineo (1979)); Mineo, 1979: 247 (junior synonym of Hadronotus flavipes Ashmead); Mineo, 1990: 178 (incorrect placement); Johnson, 1992: 393 (type information).

Gryon nixoni Masner: Masner, 1965: 77 (replacement name for Hadronotus leptocorisae Nixon, type information, synonymized with Hadronotus flavipes Ashmead by Mineo (1979)); Mineo, 1979: 247 (junior synonym of Hadronotus flavipes Ashmead); Mineo, 1981: 119, 139 (description, keyed); Mineo, 1990: 178 (incorrect placement).

Gryon ferus Masner & Muesebeck: Masner & Muesebeck, 1968: 35 (replacement name for Hadronotus flavipes Ashmead. Type information. Synonymized with Telenomus orestes Dodd by Mineo (1990a)); Mineo, 1990a: 179 (junior synonym of Gryon orestes (Dodd)).

Gryon fuscus (Dodd): Galloway, 1976: 91 (type information, generic transfer).

Gryon orestes (Dodd): Johnson, 1988b: 242 (type information, generic transfer); Mineo, 1990a: 178 (synonymy, variation); Johnson, 1992: 392 (cataloged, type information); Kononova & Kozlov, 2008: 324, 356 (description, keyed).

Hadronotus floridanus Ashmead, comb. rev.

Lectotype images in MBD: USNMENT00989854

Hadronotus floridanus Ashmead, 1887: 118 (original description); Ashmead, 1893: 231, 232 (description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 463 (description, keyed).

Hadronotus robustus Brues, 1907: 156 (original description. Synonymized by Masner (1983)); Brues, 1910: 46, 47 (diagnosis of male, keyed); Kieffer, 1926: 454, 464 (description, keyed); Masner, 1983: 136 (junior synonym of Gryon floridanum (Ashmead)); Johnson, 1992: 383 (type information).

Gryon robustus (Brues): Masner, 1965: 299 (type information, generic transfer).

Gryon floridanus (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 35 (lectotype designation).

Gryon floridanum (Ashmead): Masner, 1983: 135, 136 (description, synonymy, emendation, keyed); Mineo & Caleca, 1987: 32 (description); Johnson, 1992: 383 (cataloged, type information).

Hadronotus fulvicoxus (Komeda & Mita), comb. nov.

Gryon fulvicoxa Komeda & Mita, in Komeda, Mita, Hirose & Yamagishi, 2020: 101, 128 (original description, keyed).

Comments

The transfer to Hadronotus is based on images and characters in the original description.

Hadronotus fulviventris Crawford, comb. rev.

Holotype images in MBD: USNMENT00989855

Hadronotus fulviventris Crawford, 1912: 2 (original description).

Hadronotus antestiae Dodd, 1920a: 351 (original description. Synonymized by Mineo (1979a)); Nixon, 1934b: 292, 306 (emendation of original description, keyed); Risbec, 1950: 592 (keyed); Mineo, 1979a: 247 (junior synonym of Gryon fulviventris (Crawford)); Johnson, 1992: 383 (type information).

Gryon antestiae (Dodd): Masner, 1965: 74 (lectotype designation).

Gryon fulviventris (Crawford): Masner & Muesebeck, 1968: 35 (type information, generic transfer); Mineo, 1979a: 247 (synonymy); Mineo, 1981a: 119, 128 (diagnosis, keyed); Sharma, 1982: 336 (keyed); Lê, 2000: 98, 115 (description, keyed).

Gryon terraesanctae Mineo & Szabó, 1978b: 116 (original description. Synonymized by Mineo (1979a)); Mineo, 1979a: 247 (junior synonym of Gryon fulviventris (Crawford)); Johnson, 1992: 383 (type information).

Gryon tico Mineo & Szabó, 1978c: 96 (original description. Synonymized by Mineo (1990a)); Mineo, 1990a: 174 (junior synonym of Gryon fulviventre (Crawford)); Johnson, 1992: 383 (type information).

Gryon fulviventre (Crawford): Mineo, 1990a: 174 (emendation, variation); Johnson, 1992: 383 (cataloged, type information); Kononova & Kozlov, 2008: 322, 343 (description, keyed); Rajmohana, 2014: 34 (description, distribution).

Hadronotus gallardoi (Brèthes), comb. nov.

Notilena Gallardoi Brèthes, 1913: 85 (original description).

Gryon gallardoi (Brèthes): De Santis & Esquivel, 1966: 50 (generic transfer); Loiácono, 1980: 173 (description); Mineo & Caleca, 1987a: 37 (description); Johnson, 1992: 383 (cataloged, type information).

Comments

We transfer this species to Hadronotus based on characters in the original description, “Head punctate-umbilicate, face longitudinally impressed, crested on both sides, transverse striae and in the midst of the antennae longitudinally crested.”

Hadronotus geminus (Mineo), comb. nov.

Gryon geminum Mineo, 1991: 6 (original description, assigned to acuteangulatum species group).

Comments

The original description of G. geminum is so sparse that it can hardly be considered a description. It merely states that this species differs from G. austini by the sculpture of the frons, but with no mention of how it is different. This approach to species descriptions is of no benefit and has created significant obstacles for advancing taxonomy in this group.

Hadronotus giganteus (Mineo), comb. nov.

Gryon giganteum Mineo, 1983c: 529, 546 (original description, keyed); Johnson, 1992: 384 (cataloged, type information).

Hadronotus gnidus Nixon, comb. rev.

Hadronotus gnidus Nixon, 1934b: 292, 305 (original description, keyed. Synonymized by Mineo (1990a)); Risbec, 1950: 592, 595 (variation, keyed); Mineo, 1990a: 174 (junior synonym of Gryon fulviventre (Crawford)).

Gryon gnidum (Nixon): Mineo & Caleca, 1994: 117 (treated as valid species, distribution, assigned to fulviventre subgroup of muscaeforme group).

Comments

The original description compares this species to H. antestiae (junior synonym of H. fulviventris), and we confirm that H. fulviventris belongs in Hadronotus based on examination of the holotype. We also examined two paratypes of H. gnidus, one male and one female.

Hadronotus goliath (Masner), comb. nov.

Gryon goliath Masner, 1979: 793, 798 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information).

Hadronotus grenadensis Ashmead, comb. rev.

Hadronotus grenadensis Ashmead, 1896: 800 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 466 (description, keyed).

Gryon grenadensis (Ashmead): Masner, 1965: 76 (type information, generic transfer); Masner, 1976: 58 (description, systematic position).

Gryon grenadense (Ashmead): Johnson, 1992: 384 (cataloged, type information).

Comments

We transfer this species based on characters in the original description, “Facial impression transversely striated, margined.”

Hadronotus hectoris (Mineo), comb. nov.

Gryon hectore Mineo, 1992: 25 (original description).

Comments

We transfer this species to Hadronotus based on characters presented in the original description, “frontal depression that is moderately large and deep, finely enframed and densely striated.”

Hadronotus helavai (Masner), comb. nov.

Gryon helavai Masner, 1979: 793, 797 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information).

Hadronotus hercules (Masner), comb. nov.

Gryon hercules Masner, 1979: 793, 801 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information).

Hadronotus hiberus Nixon, comb. rev.

Hadronotus hiberus Nixon, 1934b: 292, 299 (original description, keyed); Risbec, 1950: 592 (keyed).

Gryon hiberus (Nixon): Masner, 1965: 76 (type information, generic transfer); Mineo, 1990b: 49 (description, assigned to hiberus species group); Johnson, 1992: 384 (cataloged, type information).

Comments

We transfer this species to Hadronotus based on characters from the original description, “Frons with a fairly deep, more or less oval impression which is sharply and completely margined.”

Hadronotus hidakae (Mineo), comb. nov.

Gryon hidakae Mineo, 1980b: 218, 220 (original description, keyed); Johnson, 1992: 384 (cataloged, type information); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 331, 420 (description, keyed).

Comments

We transfer this species based on the sculpturing of the frontal depression, illustrated in Figure II-1 in the original description.

Hadronotus hilaris (Mineo), comb. nov.

Gryon hilare Mineo, Mineo & Caleca, 1994: 115 (original description, assigned to aureum group).

Hadronotus hirsutioculus Girault, comb. rev.

Hadronotus hirsutioculus Girault, 1925: 183 (original description).

Gryon hirsutioculus (Girault): Galloway, 1976: 91 (type information, generic transfer).

Gryon hirsutioculum (Girault): Mineo, 1990a: 186 (emendation, type information, systematic position); Johnson, 1992: 384 (cataloged, type information); Mineo & Caleca, 1994: 114 (assigned to hirsutioculum group).

Gryon hyrsutioculum (Girault): Mineo, 1991: 39 (description, misspelling).

Comments

We transfer this species back to Hadronotus based on characters in the original description, “face bounded by an arched carina above” and “vertex is also more rudely punctured.”

Hadronotus histricus (Mineo), comb. nov.

Gryon histricum Mineo, 1991: 7 (original description, assigned to aureum species group).

Hadronotus hogenakalensis (Sharma), comb. nov.

Figure 10; Holotype images in MBD: USNMENT01197123

Gryon hogenakalensis Sharma, 1982: 329, 336 (original description, keyed); Lê, 1997: 23 (keyed); Lê, 2000: 99, 118 (description, keyed, type information).

Gryon hogenakalense Sharma: Johnson, 1992: 384 (cataloged).

Hadronotus hystericus (Mineo), comb. nov.

Gryon hystericum Mineo, 1991: 16 (original description, assigned to leptocorisae species group).

Hadronotus ialokombae (Mineo), comb. nov.

Gryon ialokombae Mineo, 1983c: 547, 551 (original description, keyed); Mineo, 1990a: 181 (description); Johnson, 1992: 385 (cataloged, type information).

Hadronotus iammancoi (Mineo), comb. nov.

Gryon iammancoi Mineo, 1983s: 530, 546 (original description, keyed); Johnson, 1992: 385 (cataloged); Kononova & Kozlov, 2008: 329, 403 (description, keyed).

Hadronotus iasonis (Mineo), comb. nov.

Gryon iasone Mineo, 1992: 21 (original description).

Comments

The original description is brief and does little to place this species. However, Mineo (1992) placed in the leptocorisae species group, which leads us to transfer it to Hadronotus, and the paratype specimen we examined belongs in Hadronotus.

Hadronotus indicus (Subba Rao & Chacko), comb. nov.

Hadrophanurus indicus Subba Rao & Chacko, 1962: 478–479 (original description, keyed)

Gryon indicum (Subba Rao & Chacko): Johnson, 1992: 385 (cataloged, type information).

Comments

We transfer this species based on characters from the original description, “frons with a shallow depression having transverse striations and a small keel between the base of the antennae.”

Hadronotus ingens (Veenakumari & Rajmohana), comb. nov.

Gryon ingens Veenakumari & Rajmohana, 2016: 44 (original description).

Comments

The transfer to Hadronotus is based on characters and figures in the original description.

Hadronotus insularis Ashmead, comb. rev.

Lectotype images in MBD: USNMENT01335839

Hadronotus insularis Ashmead, 1894: 229, 230 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 465 (description, keyed).

Gryon insularis (Ashmead): Masner, 1975: 212 (keyed); Masner, 1976: 58 (type information, description); Mineo, 1979a: 251 (description); Mineo, 1980a: 197 (junior synonym of Gryon leptocorisae (Howard)).

Gryon insulare (Ashmead): Masner, 1983: 134, 161 (description, emendation, keyed); Johnson, 1992: 385 (cataloged, type information).

Lectotype designation

We here designated specimen USNMENT01338539 as the lectotype of this species.

Hadronotus introversus (Mineo), comb. nov.

Gryon introversum Mineo, 1991: 14 (original description, assigned to introversum species group).

Comments

We transfer this species based on characters in the original description, “mandibles with 3 subequal teeth” and “epomia... complete”, and images of the head provided in Figure IV.

Figure 95. 

Phylogenetic placement of Maruzza japonica based on an expanded maximum likelihood phylogenetic analysis of the original multi-gene dataset (Figure 1) plus taxa for which only COI sequences were available. Values above branches indicate ultrafast bootstrap support values.

Hadronotus janus Nixon, comb. rev.

Hadronotus janus Nixon, 1934b: 292, 304 (original description, keyed); Risbec, 1950: 592 (keyed).

Gryon janus (Nixon): Masner, 1965: 76 (type information, generic transfer); Masner, 1976: 58 (taxonomic status); Mineo, 1983c: 532, 546 (description, keyed); Johnson, 1992: 385 (cataloged, type information); Kononova & Kozlov, 2008: 331, 422 (description, keyed).

Comments

We transfer this species back to Hadronotus based on the original description, “A species closely related to H. cous” and “Mesonotum...quite strongly rugose.”

Hadronotus japonicus Ashmead, comb. rev.

Holotype images in MBD: USNMENT00989857

Hadronotus japonicus Ashmead, 1904c: 74 (original description); Kieffer, 1926: 453, 460 (description, keyed).

Gryon japonicus (Ashmead): Masner & Muesebeck, 1968: 35 (type information, generic transfer); Mineo, 1979a: 252 (description).

Gryon japonicum (Ashmead): Mineo, 1981a: 119, 130 (description of male, emendation, keyed); Johnson, 1992: 385 (cataloged, type information); Lê, 2000: 99, 119 (description, keyed); Kononova & Kozlov, 2008: 331, 421 (description, keyed).

Gryon mischa Kozlov & Kononova, 1989: 80, 94 (original description, keyed); Kozlov & Kononova, 1990: 268, 294 (description, keyed); Johnson, 1992: 388 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 330, 413 (description, keyed); Komeda, Mita, Hirose & Yamagishi, 2020: 106 (junior synonym of Gryon japonicum (Ashmead)).

Hadronotus javensis Dodd, comb. rev.

Hadronotus javensis Dodd, 1914e: 162 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 454, 460 (description, keyed).

Gryon javense (Dodd): Johnson, 1992: 385 (cataloged, type information).

Comments

We return this species to Hadronotus based on the original description, “Head and thorax reticulately rugulose.”

Hadronotus karnalensis (Chacko & Katiyar), comb. nov.

Hadrophanurus karnalensis Chacko & Katiyar, 1961: 161 (original description); Subba Rao & Chacko, 1962: 479 (keyed).

Gryon karnalense Chacko & Katiyar: Johnson, 1992: 385 (cataloged).

Comments

We transfer this species based on the original description, “frons with a median longitudinal shallow depression with transverse striations and with a keel at the base of the antennae.”

Hadronotus kelnerpillauti (Mineo), comb. nov.

Gryon kelnerpillauti Mineo, 1983b: 286, 287 (original description, keyed); Johnson, 1992: 386 (cataloged, type information).

Hadronotus kenyotus (Mineo), comb. nov.

Gryon kenyotum Mineo, 1982b: 304 (original description); Mineo, 1990c: 90 (keyed); Johnson, 1992: 386 (cataloged, type information); Mineo, 1992: 17 (assignment to letus species group).

Comments

This species belongs in Hadronotus based on examination of a paratype specimen as well as characters from the original description, “The series of basiconic-type sensilla, lying on the middle of the ventral surface of the antennomeres A12-A7 is 2,2,2,2,2,0. Frontal depression enframed all round, its upper side connected to the median ocellus by a ledge.”

Hadronotus kozlovi (Özdikmen), comb. nov.

Gryon oculatum Kozlov & Kononova, 2004: 205 (original description); Kononova & Kozlov, 2008: 325, 360 (description, keyed).

Gryon kozlovi Özdikmen, 2011: 772 (replacement name for Gryon oculatum Kozlov & Kononova); Timokhov, 2019a: 19 (distribution).

Comments

Figure 38 of the original description illustrates a female antenna with five clavomeres.

Hadronotus krishnagiriensis (Sharma), comb. nov.

Holotype images in MBD: USNMENT01109961

Gryon krishnagiriensis Sharma, 1982: 333, 336 (original description, keyed).

Gryon krishnagiriense Sharma: Johnson, 1992: 386 (cataloged).

Hadronotus laticeps Kieffer, comb. rev.

Hadronotus laticeps Kieffer, 1908: 144 (original description); Kieffer, 1926: 453, 457 (description, keyed).

Hadronotus Laticeps Kieffer: Kieffer, 1913: 240 (description).

Gryon laticeps (Kieffer): Johnson, 1992: 386 (cataloged, type information).

Comments

We transfer this species based on the original description, “superficial frontal impression, going beyond the middle of the eyes, dull, not marginal, ridged across.”

Hadronotus latipennis (Dodd), comb. nov.

Holotype images in MBD: SAMA I.1396

Platyteleia latipennis Dodd, 1913a: 154 (original description); Dodd, 1914b: 80 (description of female); Kieffer, 1926: 409 (description, keyed); Galloway, 1976: 101 (type information).

Gryon latipennis (Dodd): Galloway & Austin, 1984: 79 (generic transfer).

Gryon latipenne (Dodd): Johnson, 1992: 386 (cataloged, type information).

Hadronotus latus (Dodd), comb.n.

Austroscelio latus Dodd, 1916: 28 (original description); Galloway, 1976: 85 (type information).

Gryon latus (Dodd): Galloway & Austin, 1984: 80 (generic transfer).

Gryon latum (Dodd): Mineo, 1990b: