Monograph |
Elijah J. Talamas‡, Jonathan S. Bremer‡, Matthew R. Moore‡, Marie-Claude Bon§, Zachary Lahey|, Cheryl G. Roberts‡, Lynn A. Combee‡, Natalie McGathey‡, Simon van Noort¶, Alexander V. Timokhov#, Evelyne Hougardy¤, Brian Hogg¤
|
Corresponding author: Elijah J. Talamas ( elijah.talamas@fdacs.gov ) Academic editor: Gavin Broad
© 2021 Elijah J. Talamas, Jonathan S. Bremer, Matthew R. Moore, Marie-Claude Bon, Zachary Lahey, Cheryl G. Roberts, Lynn A. Combee, Natalie McGathey, Simon van Noort, Alexander V. Timokhov, Evelyne Hougardy, Brian Hogg.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Talamas EJ, Bremer JS, Moore MR, Bon M-C, Lahey Z, Roberts CG, Combee LA, McGathey N, van Noort S, Timokhov AV, Hougardy E, Hogg B (2021) A maximalist approach to the systematics of a biological control agent: Gryon aetherium Talamas, sp. nov. (Hymenoptera, Scelionidae). In: Lahey Z, Talamas E (Eds) Advances in the Systematics of Platygastroidea III. Journal of Hymenoptera Research 87: 323-480. https://doi.org/10.3897/jhr.87.72842
|
 |
Abstract
A morphological and molecular analysis of Gryon Haliday (Platygastroidea, Scelionidae) was conducted to provide a taxonomic and phylogenetic context for a species under evaluation as a biological control agent of Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae). Our analysis revealed that Gryon is polyphyletic and that the biological control agent is not G. gonikopalense, a name that was tentatively applied to this species in 2019. We here describe this species as new, Gryon aetherium Talamas sp. nov., and resurrect the generic name Hadronotus Förster. Morphological characters that delimit our concepts of Gryon and Hadronotus are presented. Based on morphological characters and multilocus phylogenies, we determined that five presently valid scelionid genera belong within Gryon. In total, 15 species are transferred into Gryon from these genera, 215 species are transferred from Gryon to Hadronotus, and 6 species are transferred from Gryon to Dyscritobaeus Perkins. Specimens collected during field studies in California and reevaluation of specimens determined as G. myrmecophilum in Mexico reveal that G. aetherium is adventive in North America.
Keywords
Gryon, taxonomy, bagrada bug
Introduction
Bagrada bug, Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae), is an agriculturally destructive pest that has invaded North and South America (
Economic consequences caused by the bagrada bug were at times severe, with 53 certified organic cole crop farms in California reporting losses of $25,000 to $100,000 from bagrada bug in 2014–2015, resulting in total annual losses of $1.3 to 5.3 million for these farms alone (California Certified Organic Farmers, personal communication). This prompted the initiation of a biological control program that imported egg parasitoids from Pakistan (
Regarding taxonomic preparedness in Gryon, the North America fauna was revised by
As the project progressed, the morphological similarity between species and the appearance of vast geographical ranges for some Gryon species made it clear that this identification needed to be verified with a more intensive analysis that included both molecular data and a broader examination of specimens. The former had the potential to determine if Gryon could be separated into morphologically identifiable, monophyletic species groups and so representatives from throughout the genus were analyzed. Some characters that we found to be important for diagnosis were not used by previous workers, thus requiring a fresh examination of primary types to correctly characterize and place species. Given the species richness of Gryon, this is a laborious, ongoing task that is essential for advancing its taxonomy. It has required travel on five continents and nearly five years to make a reasonably confident statement about the identity of the parasitoid species in question.
Scelionid parasitoids of Bagrada hilaris
Field studies in North America reported seven species of scelionid wasps associated with bagrada bug eggs. Four species of Trissolcus were reared in southern California: Trissolcus basalis (Wollaston), Tr. hullensis (Harrington), Tr. utahensis (Ashmead), and the adventive Tr. hyalinipennis (
A brief history of Gryon
Gryon was erected by
Many taxonomic treatments of Gryon have been limited in scope, whereas large-scale syntheses are needed to manage a genus of its size. This situation made it clear that major reassessments of its limits and constituent species were needed, including detailed characterization of historic type specimens. We thus prioritized the examination and imaging of primary types. For species whose type material we have yet to examine, we relied on original descriptions for generic placement. This process revealed that many original descriptions are woefully inadequate, and some are so brief that they can hardly be considered the result of serious taxonomic study. Unfortunately, this phenomenon is not limited to Gryon and many taxa in Platygastroidea are plagued by a casual approach to assigning names to species.
Species groups
One of our initial goals was to delimit species groups within Gryon to facilitate revisionary projects of more manageable size. This task is beyond the scope of the current treatment. However, we are confident that our phylogenetic analyses provide a significant step toward a subgeneric classification and preliminary examination has revealed numerous morphological characters that warrant further study.
The maximalist approach
We term our approach to the systematics of G. aetherium as “maximalist” for a few reasons. First, we employed biological, morphological, and molecular species datasets in the delimitation of this species and experimentally assessed the effect of host species on intraspecific variation. This level of analysis is rarely conducted in the original description of species, and though likely not feasible for many taxa, it is warranted by the the economic and agricultural significance of G. aetherium. Second, we have simultaneously made every effort to overcome the “superficial description impediment” sensu
Material and methods
Collections
Specimens on which this work is based are deposited in the following repositories with abbreviations used in the text:
ICIPE International Centre of Insect Physiology and Ecology, Nairobi, Kenya
IEBR Institute of Ecology and Biological Resources, Hanoi, Vietnam
Multilocus phylogeny
Extraction, amplification, and sequencing were performed at the European Biological Control Laboratory (EBCL) and the Florida State Collection of Arthropods (
| Primer | Sequence (5’-3’) | Citation |
|---|---|---|
| 18S-H17F | AAATTACCCACTCCCGGCA |
|
| 18S-H35R | TGGTGAGGTTTCCCGTGTT | |
| 28S-D23F | GAGAGTTCAAGAGTACGTG |
|
| 28S-b | TCGGAAGGAACCAGCTACTA |
|
| SceWgIF-1 | GTAAGTGTCACGGGATGTC |
|
| SceWgIR-1 | TTGACTTCACAGCACCAGT | |
| LCO1490 | GGTCAACAAATCATAAAGATATTGG |
|
| HCO2198 LCO1490puc HCO2198puc | TAAACTTCAGGGTGACCAAAAAATCA TTTCAACWAATCATAAAGATATTGG TAAACTTCWGGRTGWCCAAARAATCA |
|
| LEP-F1 | ATTCAACCAATCATAAAGATAT |
|
| LEP-R1 C1-J-1632 C1-N-2191 | TAAACTTCTGGATGTCCAAAAA TGATCAAATTTATAAT CCCGGTAAAATTAAAATATAAACTTC |
|
PCRs targeted four loci: two nuclear ribosomal genes, 18S rRNA (variable region V3-V5) and the 28S rRNA (D2-D3 expansion regions), the nuclear gene Wingless (exon), and the mitochondrial 5’ end of the cytochrome c oxydase subunit I gene (COI), also named the barcode region. These loci were selected for their compatibility with previous datasets examining the relationships of platygastroid species across several taxonomic scales (Murphy et al. 2007;
The COI barcode was predominantly amplified using the primers of
PCRs utilized the KAPA HiFi HotStart Readymix Kit (Roche Diagnostics) per the manufacturer’s protocol in 25 µL reactions (Table
| Primers | Thermocycle |
|---|---|
| 18S-H17F/18S-H35R | 1) 98C/3 min; 35× of steps 2–4: 2) 95C/30 sec; 3) 52C/45 sec; 4) 72C/1 min; 5) 72C/10 min; 4C/∞ |
| 28S-D23F/28S-b | 1) 98C/3 min; 35× of steps 2–4: 2) 95C/30 sec; 3) 57C/45 sec; 4) 72C/1 min; 5) 72C/10 min; 4C/∞ |
| SceWgIF-1/SceWgIR-1 | 1) 98C/3 min; 35× of steps 2–4: 2) 95C/30 sec; 3) 60C/30 sec; 4) 72C/1 min; 5) 72C/7 min; 4C/∞ |
| LCO1490/HCO2198; LEP-F1/LEP-R1 | 1) 98C/3 min; 32× of steps 2–4: 2) 95C/30 sec; 3) 50C/30 sec; 4) 72C/45 sec; 5) 72C/7 min; 4C/∞ |
| LCO1490puc/HCO2198puc | 1) 94C/3 min; 10× of steps 2–4: 2) 94C/30 sec; 3) 48C/1 min; 4) 72C/1 min ; 30× of steps 2–4: 2) 94C/30 sec; 3) 50C/1 min; 4) 72C/1 min; 5) 72C/10 min; 4C/∞ |
| C1-J-1632/C1-N-2191 | 1) 95C/2 min; 30× of steps 2–4: 2) 98C/20 sec; 3) 40C/30 sec; 4) 72C/ 30 sec; 5) 72C/7 min; 4C/∞ |
Probaryconus Kieffer was selected as the furthest scelionid outgroup to root the phylogenetic analyses based on the topologies of
COI barcode analysis
The Barcode of Life Database (BOLD;
Initial COI alignments revealed several indel events across Scelionidae. The COI alignment contained 479 scelionid terminals. DNA sequences were translated into amino acids using the invertebrate mitochondrial translation table and aligned using the default settings of MUSCLE (
Phylogenetic placement of Maruzza Mineo
While screening sequences for potential contaminants and after conducting the phylogenetic analyses presented in Figures
Imaging
Photographs were captured with multiple imaging systems: a Z16 Leica lens with a JVC KY-F75U digital camera using Cartograph and Automontage software; an Olympus BX51 compound microscope with a Canon EOS 70D digital SLR camera; and a Leica DM2500 compound microscope with a Leica DFC425 camera; and a Leica M165 compound microscope with a Leica DFC450 camera. Illumination was achieved with a lighting dome or with LED gooseneck lamps and mylar light dispersers. Images were rendered from Z-stacks with Automontage, Helicon Focus or Zerene Stacker. In some cases, multiple montage images were stitched together in Photoshop to produce larger images at high resolution and magnification.
Dissections for scanning electron microscopy were performed with a minuten probe and forceps. Body parts were mounted to a 12 mm slotted aluminum mounting stub (EMS Cat. #75220) using a carbon adhesive tab (EMS Cat. #77825-12) and sputter coated with approximately 70 nm of gold/palladium using Cressington 108 and Denton IV sputtercoaters. Micrographs were captured using a Hitachi TM3000 Tabletop SEM and a Phenom XL G2 Desktop SEM.
Data deposition and informatics
Results of the phylogenetic analyses and their corresponding sequence matrices and partition files have been deposited in Dryad (https://doi.org/10.5061/dryad.dbrv15f18).
The numbers prefixed with acronyms, e.g., “USNMENT” or “
Images of many primary types were made available by the Platygastroidea Planetary Biodiversity Inventory and the photographic catalogs of
Character annotations
atc acetabular carina (Figure
ats postacetabular sulcus (Figure
axu axillula (Figures
eps episternal foveae (Figure
lpc lateral propodeal carina (Figure
lpS1 lateral pit on S1 (Figures
lpT1 lateral pit on T1 (Figures
mc mesopleural carina (Figures
mes mesopleural epicoxal sulcus (Figure
mtpl metapleuron (Figures
oc occipital carina (Figure
ps papillary sensilla (Figure
s seta (Figures
sc sublateral carina on T1 (Figures
sgs subgenual spines (Figures
spf sulcus of propodeal foramen (Figures
T1 metasomal tergite 1 (Figure
vplc ventral mesopleural carina (Figure
Quarantine rearing
To assess intraspecific variability, we examined G. aetherium that were reared from multiple pentatomid species during host specificity testing. Bagrada hilaris, Thyanta custator (Fab.), Holcostethus abbreviatus Uhler, Banasa sordida (Uhler) and Euschistus conspersus Uhler were collected in north-central California (Monterey, Alameda, Solano or Yolo counties) and maintained in laboratory cultures at the USDA-ARS in Albany, CA, under 28–30 °C, 30–40% RH and 16L:8D photoperiod. A laboratory colony of G. aetherium was maintained in the USDA-ARS quarantine facility in Albany, California, under 22–27 °C, 40–60% RH and 14L:10D, and host specificity tests were conducted in quarantine under the same conditions. Tests followed a no-choice design, whereby individual parasitoids were exposed to one species of pentatomid egg in glass vials. Clusters of 10–15 fresh pentatomid eggs (<24 h old) were glued onto strips of card stock (20 × 60 mm) using Elmer’s Glue-All (Elmer’s Products Inc., Westerville, OH) and placed in glass vials (25 mm diameter × 95mm high), and one 24- to 48-hour-old, mated female parasitoid was then released into each vial and removed after 24 hours. At least one vial containing B. hilaris eggs was also exposed to parasitoids, when possible, to compare the suitability of non-target pentatomids and B. hilaris to the parasitoids. Eggs were then monitored, and numbers of parasitized eggs and emerging pentatomids and parasitoids were recorded. Unhatched eggs were then dissected after ~30 days to record numbers of parasitoid larvae that failed to complete development.
Results
Molecular systematics
We used multiple genetic loci and extensive taxon sampling within Platygastroidea to infer the placement of Gryon aetherium. The concatenated alignment consisted of 194 taxa, 2,706 sites (base pairs and gaps), and 4.3% missing data. Eighty-one (41%) of the 194 taxa were determined as Gryon. Three independent phylogenetic analyses were performed on the alignment that differed by the type of branch support metric (ultrafast bootstrap, non-parametric bootstrap) or tree search strategy (maximum-likelihood, parsimony) employed (Figures
The taxa initially determined as belonging to Gryon were recovered as a polyphyletic assemblage composed of two clades. Clade A, with 35 taxa, forms a maximally supported (99–100% support) terminal cluster of species that is sister to a weakly supported (76% UFBS, 17% NPBS) clade of spider-egg parasitoids (Idris Förster, Ceratobaeus Ashmead) (Figure
Best tree from the multi-gene, maximum likelihood phylogenetic analysis of Scelionidae conducted in IQ-TREE. Branch support values were generated from 10,000 ultrafast bootstrap replicates and are indicated above branches. The positions of Hadronotus (Clade A), Gryon (Clade B), and Dyscritobaeus (Clade B) are indicated in green, blue, and red, respectively.
Position and phylogenetic relationships of Hadronotus relative to other Scelionidae based on the topology depicted in Figure
Position and phylogenetic relationships of Gryon relative to other Scelionidae based on the topology depicted in Figure
COI barcoding
Sequencing efforts generated 124 new COI barcodes. Annotation of COI amino acids demonstrated that at least four, possibly six, indel phenotypes were present in the scelionid dataset (Table
COI amino acid phenotypes of Scelionidae. Taxa are listed and colored according to phenotype. Gryon and Hadronotus are highlighted in blue.
| Genus | No. Seq. | Helix 1 | Loop 1 | Helix 2 | Loop 2 | Helix 3 | Loop 3 | Helix 4 | Loop 4 | Helix 5 | Loop 5 | Helix 6 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Acolomorpha | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Amblyscelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Anteromorpha | 1 | – | – | – | – | No | 3 AA deletion | No | No | No | No | No |
| Apteroscelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Calliscelio | 1 | – | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Calotelea | 2 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Ceratobaeus | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Cremastobaeus | 2 | – | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Dicroscelio | 1 | – | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Duta | 1 | – | – | – | – | No | 3 AA deletion | No | No | No | No | No |
| Dyscritobaeus | 2 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Elgonia | 1 | – | – | – | – | No | 3 AA deletion | No | No | No | No | No |
| Embidobia | 1 | – | – | – | – | No | 3 AA deletion | No | No | No | No | No |
| Fusicornia | 1 | – | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Gryon | 157 | No | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Heptascelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Idris | 3 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Leptoteleia | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Macroteleia | 3 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Mantibaria | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Maruzza | 1 | – | – | No | No | No | 3 AA deletion | No | No | No | No | No |
| Masnerella | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Neoscelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Odontacolus | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Oreiscelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Oxyscelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Oxyteleia | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Parascelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Paratelenomus | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Platyscelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Probaryconus | 2 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Pseudanteris | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Pseudoheptascelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Psilanteris | 3 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Psix | 2 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Romilius | 2 | – | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Scelio | 4 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Shreemana | 1 | – | – | – | – | No | 3 AA deletion | No | No | No | No | No |
| Spiniteleia | 1 | – | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Synoditella | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Tiphodytes | 2 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Trichoteleia | 2 | No | No | No | No | No | 3 AA deletion | No | No | No | No | No |
| Trissoscelio | 1 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| Triteleia | 2 | – | – | – | No | No | 3 AA deletion | No | No | No | No | No |
| (Gryon) Breviscelio | 8 | No | 1 AA deletion | No | No | No | 3 AA deletion | No | No | No | No | No |
| Acanthoscelio | 1 | – | – | – | No | No | 3 AA deletion | No | 1 AA deletion | No | No | No |
| Baryconus | 1 | – | No | No | No | No | 3 AA deletion | No | 1 AA deletion | No | No | No |
| Gryonoides | 1 | – | No | No | No | No | 3 AA deletion | No | 3 AA deletion* | No | No | No |
| Teleasinae gen. sp. | 1 | – | – | – | – | No | 3 AA deletion | No | 1 AA deletion | No | No | No |
| Trimorus | 1 | – | – | – | No | No | 3 AA deletion | No | 1 AA deletion | No | No | No |
| Anteris | 1 | – | – | – | – | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Axea | 1 | – | – | – | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Dichoteleas | 1 | – | – | – | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Eumicrosoma | 1 | No | No | No | No | No | 3 AA deletion | No | 2 AA deletion | No | No | – |
| Hadronotus | 169 | No | No | No | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Mallateleia | 1 | – | – | – | – | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Paridris | 5 | – | – | – | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Phanuromyia | 1 | – | – | – | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Platyscelidris | 1 | – | – | – | No | No | 2 AA deletion** | No | 2 AA deletion | No | No | No |
| Telenomus | 43 | No | No | No | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Thoron | 2 | – | – | – | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Thoronella | 1 | – | – | – | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
| Trissolcus | 22 | No | No | No | No | No | 3 AA deletion | No | 2 AA deletion | No | No | No |
COI barcoding of G. aetherium from Mexico, California, and the quarantined colony collected from Pakistan revealed two haplotypes, differing by two synonymous substitutions. One of the haplotypes is a 100% match to two specimens, previously determined as G. myrmecophilum from Coahuila, Mexico (MK720831 and MK720832). These specimens (
Maximum-likelihood tree searches of the scelionid COI barcode dataset recovered a bootstrap consensus tree of log-likelihood -39550.451 (Figure
Phylogenetic relationships of Scelionidae based on a maximum likelihood analysis of 479 COI sequences. Branches in blue and red indicate Hadronotus and Gryon, respectively. Terminals belonging to G. aetherium are shown to the right of the phylogenetic tree. Terminals highlighted in yellow correspond to adventive G. aetherium specimens collected in Mexico and California. Scale bars indicate the expected number of substitutions per site.
Character discussion
Axillula
The scutellar-axillar complex is a rich source of characters that have yet to be fully exploited in the taxonomy of Platygastroidea. Striation within the area delimited by the axillar, transaxillar, and axillular carinae can take a variety of forms (Figures
Scutellar-axillar complex, lateral view 5 Gryon aetherium (USNMENT01109155) 6 Duta (USNMENT01109621_2) 7 Hadronotus hogenakalensis (DPI_FSCA 00008722) 8 Hadronotus carinatifrons (USNMENT01335649).
Metapleuron
The metapleuron in Gryon has 1–3 setae in the anterodorsal corner and occasionally a single seta in the dorsal metapleural area, but it is otherwise glabrous (Figure
Metasomal tergite 1
In Gryon, the line of foveae along the anterior margin of T1 terminates laterally at a carina (Figure
Metasoma 15 Gryon aetherium (
Diagnostic summary
| 1 | Clypeus not projecting ventrally; antennal scrobe with transverse sculpture; metapleuron divided dorsoventrally by a change in sculpture or setation; metapleuron usually setose in posterior portion; hind tibia without subgenual spines; foveae along anterior T1 decreasing in size laterally, not bordered laterally by a carina or pit | Hadronotus Förster |
| – | Clypeus projecting ventrally, usually with sharp lateral corners; antennal scrobe without transverse sculpture; metapleuron undivided dorsoventrally by a change in sculpture or setation; metapleuron with 1–3 setae in anterodorsal corner, sometimes with a single seta in dorsal metapleural area, otherwise glabrous; hind tibia with subgenual spines; foveae along anterior T1 roughly equal in size, ending in a sublateral carina or pit | Gryon Haliday |
Images
Links to images of primary or secondary types are provided in the treatment for each species. Table
A summary of the genera treated as junior synonyms of Gryon and Hadronotus with links to available images of primary types.
| Genus | Date | Type species | Images of Type Specimen |
|---|---|---|---|
| Gryon Haliday | 1833 | Gryon misellum Haliday | https://zenodo.org/record/4498847#.YBrybXlOlaQ |
| Acolus Förster | 1856 | Acolus opacus Thomson | |
| Plastogryon Kieffer | 1908 | Plastogryon foersteri Kieffer | |
| Psilacolus Kieffer | 1908 | Acolus xanthogaster Ashmead | USNMENT00989056 |
| Holacolus Kieffer | 1912 | Acolus opacus Thomson | |
| Plesiobaeus Kieffer | 1913 | Plesiobaeus hospes Kieffer | |
| Hadronotellus Kieffer | 1917 | Hadronotellus pedester Kieffer | ZMUC 0002 |
| Heterogryon Kieffer | 1926 | Plastogryon sagax Kieffer | |
| Synteleia Fouts | 1927 | Synteleia coracina Fouts | USNMENT00989057 |
| Eremioscelio Priesner | 1951 | Eremioscelio cydnoides Priesner | USNMENT01059665 |
| Hungarogryon Szabó | 1966 | Hungarogryon moczari Szabó | Hym.Typ.No. 9634, Mus.Budapest |
| Masneria Szabó | 1966 | Hadronotus lymantriae Masner | |
| Pannongryon Szabó | 1966 | Pannongryon szelenyii Szabó | https://zenodo.org/record/4521320#.YCGzRnlOlaQ |
| Sundholmia Szabó | 1966 | Sundholmia nitens Szabó | |
| Breviscelio Sundholm | 1970 | Breviscelio crenatus Sundholm | https://www.flickr.com/photos/127240649@N08/50616991701/in/photolist-2k7Rjat-2k7Mx3Y-2k7Rj9M-2k7RTii-2k7Rja8/ |
| Exon Masner | 1980 | Exon californicum Masner | |
| Hadronotus Förster | 1856 | Hadronotus exculptus Förster | https://zenodo.org/record/4504407#.YCGDd3lOlaQ |
| Muscidea Motschoulsky | 1863 | Muscidea pubescens Motschoulsky | https://zenodo.org/record/4924954#.YOSoF0lKhaQ |
| Hadronotoides Dodd | 1913 | Hadronotus pentatomus Dodd |
|
| Platyteleia Dodd | 1913 | Platyteleia latipennis Dodd |
|
| Telenomoides Dodd | 1913 | Telenomoides flavipes Dodd | https://zenodo.org/record/5188097#.YRUi0MpKhaQ |
| Notilena Brèthes | 1913 | Notilena gallardoi Brèthes | |
| Austroscelio Dodd | 1914 | Sparasion nigricoxa Dodd |
|
| Hadrophanurus Kieffer | 1926 | Telenomus pennsylvanicus Ashmead | https://zenodo.org/record/4520251#.YCGBzXlOlaQ |
List of specimens from the molecular analysis that have been photographed. It includes all specimens of Gryon and representatives for each species of Hadronotus.
Gryon
Gryon
Haliday, 1833: 271 (original description. Type species: Gryon misellum Haliday, by monotypy, keyed); Walker, 1836: 343 (description); Westwood, 1840: 77 (description); Blanchard, 1840: 289 (junior synonym of Teleas Latreille); Brullé, 1846: 619 (description); Förster, 1856: 101, 105 (diagnosis, keyed); Marshall, 1873: 16 (catalog of species of Britain); Walker, 1874: 9 (keyed); Howard, 1886: 172 (keyed); Cresson, 1887: 84 (keyed); Ashmead, 1893: 181, 205 (description, keyed, key to species of U.S. and Canada); Dalla Torre, 1898: 502 (catalog of species); Ashmead, 1900: 327 (list of species of West Indies); Ashmead, 1903: 90 (keyed); Kieffer, 1908: 188, 189 (description, keyed); Brues, 1908: 19, 25, 49 (diagnosis, keyed, list of species); Kieffer, 1910: 91, 92 (description, list of species, keyed); Kieffer, 1912: 109 (description); Kieffer, 1913: 212 (description, taxonomic status, key to species of Europe and Algeria); Dodd, 1914a: 75 (keyed); Kieffer, 1926: 173, 260 (description, keyed, key to species); Morley, 1929: 54 (catalog of species of Britain); Dodd, 1930: 42 (keyed); Nixon, 1936: 115 (taxonomic status, position); Maneval, 1940: 112, 113 (keyed); Fouts, 1948: 92 (keyed); Muesebeck & Walkley, 1951: 356 (citation of type species); Masner, 1961: 158 (synonymy, systematic position, description); Kozlov, 1963a: 354, 357 (description, key to species of USSR, keyed); Kozlov, 1963b: 661, 667 (description, keyed, key to species); Szabó, 1966: 422 (keyed); De Santis, 1967: 225 (catalog of species of Argentina); Safavi, 1968: 418 (parasitized eggs of Scutelleridae keyed); Hellén, 1971: 5, 21 (description, keyed); Kozlov, 1971: 38 (keyed); Kozlov, 1972: 654 (key to new species described); Alayo Dalmau, 1973: 99 (catalog of species of Cuba); Simons, Reardon & Ticehurst, 1974: 15 (keyed); Viggiani & Mineo, 1974: 160, 161 (keyed); Mani & Mukerjee, 1976: 497 (key to new species described); Masner, 1976: 7, 57 (description, synonymy, keyed); Fergusson, 1978: 118 (checklist of species of Britain); Kozlov, 1978: 619 (description, key to species of European USSR); Mineo, 1979b: 91 (diagnosis, key to species parasitizing Aelia and Eurygaster (Hemiptera: Pentatomidae)); Muesebeck, 1979: 1157 (catalog of species of U.S. and Canada); Masner, 1980: 12, 13 (keyed); Mineo, 1980b: 216 (diagnoses and keys to species of insulare and pubescens species groups); De Santis, 1980: 311 (catalog of species of Brazil); Mineo, 1981a: 119 (description and key to species of the muscaeformis species group); Mani & Sharma, 1982: 152, 191 (description, keyed); Mineo & Villa, 1982b: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 134 (taxonomic value of structures on the posterior surface of the head); Sharma, 1982: 336 (key to species of India); Masner, 1983: 126, 127 (description, morphology, division into species groups, key to species of North America, keyed); Mineo, 1983b: 285 (description and key to species of the pubescens species group); Mineo, 1983c: 546, 551 (descriptions and keys to species of the insulare and oculatum species groups); Mineo, 1983a: 12 (description and key to species of the charon species group); Galloway & Austin, 1984: 6, 78 (diagnosis, synonymy, list of species described from Australia, keyed); Mineo & Caleca, 1987b: 41 (diagnoses of the misellum, artum, austrafricanum and hospes species groups; key to species of the artum group); Kozlov & Kononova, 1989: 78 (key to species of the USSR); Kozlov & Kononova, 1990: 96, 265, 266 (description, division into species groups, key to species of Palearctic, keyed); Caleca, 1990a: 116 (description, key to species of pentatomum group); Mineo, 1990a: 171, 174, 180, 182 (description of artum, muscaeforme, myrmecophilum, oculatum, pubescens groups); Mineo, 1990b: 49, 52 (description of hiberus, leptocorisae species groups); Mineo, 1990c: 90 (description of letus group, key to species of letus group); Mineo, 1991: 1, 2, 7, 9, 10, 12 (description of aculum, acuteangulatum, aureum, cydnoide, hungaricum, introversum species groups, synonymy, key to species of hungaricum group); Johnson, 1992: 374 (cataloged, catalog of world species); Mineo & Caleca, 1994: 114, 116, 121, 127 (designation of hirsuticolum group, fulviventre subgroup of muscaeforme group, subfasciatum group, lymantriae group, key to species of lymantriae group); Kononova, 1995: 62, 81 (keyed, diagnosis, key to species of Russian Far East); Austin & Field, 1997: 36, 68 (structure of ovipositor system, discussion of phylogenetic relationships); Lê, 2000: 32, 95 (keyed, description, key to species of Vietnam); Kononova & Petrov, 2001: 1468 (description); Kononova & Petrov, 2002: 53 (key to species of Palearctic); Loiácono & Margaría, 2002: 557 (catalog of Brazilian species); Rajmohana K., 2006: 115, 123 (description, keyed); Fabritius & Popovici, 2007: 11, 13, 14, 26, 29, 63 (description, key to Romanian species, key to species related to Gryon longiabdominalis and buhli, keyed); Kononova & Kozlov, 2008: 25, 321, 322 (description, keyed, key to species of Palearctic region); Popovici & Johnson, 2012: 382 (description of internal genitalia); Rajmohana, 2014: 8, 33 (description, keyed); Talamas & Buffington, 2015: 21 (fossil in Dominican amber). Comments. The lectotype and paralectotype specimens of G. misellum Haliday are in excellent condition considering their age (~190 years old) and these specimens display all the diagnostic characters that we associate with the genus (Figures
Acolus
Förster, 1856: 100, 102 (original description. Type species: Acolus opacus Thomson, designated by
Plastogryon
Kieffer, 1908: 119, 141 (original description. Type: Plastogryon foersteri Kieffer, designated by
Psilacolus
Kieffer, 1908: 179, 180 (original description. Type species: Acolus xanthogaster Ashmead, designated by
Holacolus Kieffer, 1912: 89, 106 (original description. Type species: Acolus opacus Thomson, designated by Muesebeck & Walkley (1956). Key to species of Europe and Algeria); Kieffer, 1926: 133, 169 (description, keyed, key to species); Jansson, 1939: 173 (keyed); Maneval, 1940: 111 (keyed); Muesebeck & Walkley, 1956: 359 (designation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday).
Plesiobaeus
Kieffer syn. rev., 1913: 229, 282 (original description. Type: Plesiobaeus hospes Kieffer, by monotypy); Kieffer, 1926: 271, 556 (description, keyed); Morley, 1929: 54 (catalog of species of Britain); Jansson, 1939: 172 (keyed); Maneval, 1940: 112 (keyed); Muesebeck & Walkley, 1956: 386 (citation of type species); Szabó, 1966: 422 (keyed); Kozlov, 1971: 38 (keyed); Fergusson, 1978: 118 (checklist of species of Britain); Kozlov, 1978: 621 (description); Mineo, 1979a: 248 (junior synonym of Gryon Haliday); Masner, 1980: 13 (keyed); Kozlov & Kononova, 1990: 96, 265, 307 (description, keyed); Fabritius & Popovici, 2007: 11, 34, 63 (description, keyed); Kononova & Kozlov, 2008: 25, 445 (description, keyed, treated as valid genus). Comments.
Hadronotellus
Kieffer, 1917: 341 (original description. Type: Hadronotellus pedester Kieffer, by monotypy and original designation. Synonymized by
Heterogryon
Kieffer, 1926: 271, 446, 448 (original description. Type: Plastogryon sagax Kieffer, designated by Muesebeck & Walkley (1956). Proposed as a subgenus of Plastogryon, keyed. Synonymized by
Eremioscelio
Priesner syn. rev., 1951: 129 (original description. Type: Eremioscelio cydnoides Priesner, by monotypy and original designation); Muesebeck & Walkley, 1956: 351 (citation of type species); Kozlov, 1963a: 354, 357 (description, keyed); Kozlov, 1963b: 661, 666 (description, keyed); Kozlov, 1971: 38, 49 (synonymy, keyed); Kozlov, 1972: 656 (key to species); Masner, 1976: 59 (description); Kozlov, 1978: 621 (description, key to species of European USSR); Kozlov & Kononova, 1990: 95, 265, 310, 311 (description, key to species of USSR, keyed); Mineo, 1991: 1, 9 (junior synonym of Gryon Haliday, described as cydnoide species group); Johnson, 1992: 372 (cataloged, catalog of world species); Kononova, 1995: 62, 85 (keyed, diagnosis, key to species of Russian Far East); Fabritius & Popovici, 2007: 11, 36, 63 (description, key to Romanian species, keyed); Kononova & Kozlov, 2008: 25, 451 (description, keyed, key to species of Palearctic region, treated as a valid genus). Comments. Images of the holotype specimen of Eremioscelio cydnoides illustrate important diagnostic characters of Gryon: the lateral pit on T1 and the presence of subgenual spines (Figures
Hungarogryon
Szabó syn. n., 1966: 422, 443 (original description. Type: Hungarogryon moczari Szabó, by monotypy and original designation, keyed); Kozlov, 1971: 38 (keyed); Kozlov, 1978: 621 (description); Masner, 1980: 13 (keyed); Kozlov & Kononova, 1990: 96, 265, 320 (description, keyed); Johnson, 1992: 402 (cataloged, catalog of world species); Fabritius & Popovici, 2007: 63 (keyed); Kononova & Kozlov, 2008: 25, 461 (description, keyed). Comments.Gryon moczari (=Hungarogryon moczari) was the sole species in Hungarogryon, and is very small, only slightly longer than 0.5 mm in length. We place this species in Gryon based on the presence of subgenual spines on the hind tibia (Figure
Masneria
Szabó, 1966: 422, 442 (original description. Type: Hadronotus lymantriae Masner, by monotypy and original designation, keyed. Synonymized by
Pannongryon
Szabó, 1966: 422, 435 (original description. Type: Pannongryon szelenyii Szabó, by original designation. Key to species known to author, keyed. Synonymized implicitly by
Sundholmia
Szabó, 1966: 422, 438 (original description. Type: Sundholmia nitens Szabó, by monotypy and original designation, keyed. Synonymized by
Breviscelio
Sundholm syn. n., 1970: 383 (original description. Type: Breviscelio crenatus Sundholm, by monotypy and original designation); Mineo & Villa, 1982b: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 138 (taxonomic value of structures on the posterior surface of the head); Caleca, 1990b: 139 (description); Johnson, 1992: 354 (cataloged, catalog of world species); Caleca, 1992: 52, 53 (key to species, discussion of relationships); Austin & Field, 1997: 39, 68 (structure of ovipositor system, discussion of phylogenetic relationships) Comments. Our treatment of Breviscelio as a junior synonym of Gryon is supported by molecular and morphological evidence. Specimens of Gryon crenatum (=Breviscelio crenatus, the type species of Breviscelio) were retrieved within the Gryon clade in the 4-gene and COI analyses. The striate axillula and the lateral pit on T1 are visible in the holotype specimen (Figure
Exon
Masner syn. rev., 1980: 12, 22 (original description. Type: Exon californicum Masner, by original designation, keyed. Synonymized by
Diagnosis
Head with coriaceous microsculpture throughout; mandibles usually bidentate with teeth large and roughly equal in size, sometimes tridentate with medial tooth the smallest; clypeus projecting, typically with pointed corners; ventral frons sometimes with weakly indicated facial striae; central keel present or absent; antennal scrobe convex to concave, without transverse rugae or striation, never delimited by carinae; female antenna with ten flagellomeres (nine in G. paradigma) and four clavomeres (three in G. moczari); mesoscutum and mesoscutellum with coriaceous microsculpture throughout, occasionally with longitudinal striation or microsculpture in the form of transverse waves; epomial carina absent or weakly developed; netrion absent; mesoscutal suprahumeral sulcus absent; mesoscutal humeral sulcus absent or indicated by a smooth furrow; mesoscutum without humeral pit (sensu
The two most unusual species, as far as diagnostic characters are concerned, are G. moczari and G. paradigma. The former is discussed in the comments section for the synonymy of Hungarogryon. Gryon paradigma is unusual in that the females have eleven antennomeres instead of twelve, the ventrolateral corners of the clypeus are not pointed, and the axillular striae are wavy and irregular (Figures
Gryon paradigma (CNC664037) 26 head, anterior view 27 mesosoma and T1, dorsolateral view 28 hind leg, lateral view.
Species of Gryon
Gryon aetherium , sp. nov.
Description
Color of body: dark brown to black. Color of legs: coxae and femora brown; trochanters, tibiae and tarsi yellow to pale brown.
Color of antenna in female: yellow to pale brown, A9–A12 generally darker than preceding antennomeres.
Head: Number of mandibular teeth: 2. Shape of mandibular teeth: large, teeth roughly equal in size. Shape of clypeus: projecting ventrally, apex flat to convex, with sharp lateral corners. Number of clypeal setae: 6. Epiclypeal carina: absent. Facial striae: present as lines of microsculpture. Central keel: present. Line of setae above interantennal process: absent. Malar striae: present as lines of microsculpture. Genal carina: absent. Hyperoccipital carina: absent. Anterior margin of occipital carina on gena: smooth. Occipital carina: present dorsally and in ventral portion of gena, absent or weakened posterodorsal to compound eye.
Mesosoma: Epomial carina: absent. Sculpture of lateral pronotum: reticulate microsculpture. Netrion sulcus: absent. Mesoscutal suprahumeral sulcus: absent. Mesoscutal humeral sulcus: absent. Sculpture of mesoscutum: reticulate microsculpture.
Sculpture of mesoscutellar disc: reticulate microsculpture. Posterior mesoscutellar sulcus: foveate. Posterior margin of mesoscutellum: extending over metanotum, metascutellum not visible in dorsal view. Posterior margin of metascutellum: slightly convex. Sculpture on posteroventral surface metascutellum: weakly rugulose. Sculpture of metanotal trough: foveate. Length of postmarginal vein in fore wing: about 1.5 times as long as stigmal vein. Length of marginal vein in fore wing: about half as long as stigmal vein. Wing color: hyaline with transverse band of infuscation posterior to marginal vein. Shape of submarginal vein: straight in basal 4/5, with dip proximal to reaching wing margin.
Lateral propodeal carina: continuous across posterior propodeum, forming flange around metasomal depression. Sculpture of metasomal depression: weakly rugulose. Sulcus of the propodeal foramen: foveate dorsally, absent ventrally. Cells or foveae along ventral margin of mesopleural carina: absent. Posterior limit of acetabulum: acetabular carina intersecting with ventral mesopleural carina. Postacetabular sulcus: foveate. Mesopleural epicoxal sulcus: foveate. Episternal foveae: present. Mesopleural carina: absent; present only at ventral apex of femoral depression. Sculpture of anteroventral mesopleuron: reticulate microsculpture. Sculpture of femoral depression: smooth. Prespecular sulcus: foveate. Sculpture of speculum: finely striate. Shape of subalar pit: circular. Mesepimeral sulcus: comprised of transverse foveae, foveae absent or reduced in size posterior to speculum. Sculpture of posterior mesepimeral area: smooth. Paracoxal sulcus: indicated by transverse foveae, extending below metapleural pit but not to ventral margin of metapleuron. Metapleural epicoxal sulcus: indicated by crenulae or indistinguishable from rugose sculpture. Metapleural structure: not divided into anterior and posterior areas. Sculpture of dorsal metapleural area: transversely striate. Sculpture of ventral metapleural area: irregularly rugose.
Metasoma: Macrosculpture of T1: longitudinally striate, smooth along posterior margin. Setation of T1: present lateral and posterior to lateral pit of T1. Setation of T2–T5: dense in lateral part of tergite, absent medially except for a transverse line of sparse setae along posterior margin. Posterior margin of T6: concave. Sculpture of T2–T4: finely reticulate with a smooth band along posterior margin. Sculpture of S2: finely reticulate. Setation of laterotergites: present. Transverse sulcus on anterior S2: present as a line of small foveae.
Etymology
The species epithet “aetherium” derives from Latin, meaning of the sky or heavens, and refers to the unexpected appearance of this species in North America, far from its native range.
Diagnosis
Gryon aetherium is best separated from other Gryon species by the following characters: mesopleural carina entirely absent or present only at ventral apex of mesopleuron; posterior margin of mesoscutellum protruding posteriorly, concealing metascutellum and metanotal trough in dorsal view; mesopleuron with two episternal foveae; foveae of mesepimeral sulcus attenuating in size dorsally, foveae small or undefined posterior to speculum; acetabular carina and ventral mesopleural carina intersecting ventrally; metapleuron not transversely striate throughout; fore wing with infuscation posterior to marginal vein; hind tibia with four subgenual spines; lateral propodeal carina horizontal, extending laterally to metapleural carina.
In North America, Gryon aetherium is most similar to G. myrmecophilum, from which it is most easily separated by the mesopleural carina: complete in G. myrmecophilum, extending from the posteroventral apex of the femoral depression to the anterior margin of the mesopleuron; absent or present only at ventral apex of mesopleuron in G. aetherium. This character also serves well to separate G. aetherium from G. gonikopalense (Figures
Intraspecific variation
Non-target testing of G. aetherium in quarantine enabled us to examine how different hosts affect the phenotype of the parasitoids. Overall, we found very little variation between specimens of G. aetherium reared from Bagrada hilaris, Thyanta custator, Holcostethus, Banasa sordida and Euschistus conspersus (Figures
Prior misidentifications
Gryon aetherium was misidentified twice by the first author: as G. gonikopalense in
Adventive populations
As implied by the previous paragraph, G. aetherium has been present in Mexico since at least June of 2018 and the study by
Material examined
Holotype, female: Pakistan: Punjab, Toba Tek Singh, Dabanwala leg. R. Mahmood, coll. 5–9.IV.2016, ex. eggs Bagrada hilaris 11-V-2016 on mustard, introduced to quarantine for EBCL colony, PP8, USNMENT01335778 (deposited in
Gryon africanum
Gryon africanum Mineo, 1991: 19 (original description, assigned to myrmecophilum species group).
Gryon amphiboli
Gryon amphiboli Mineo, 1991: 19 (original description, assigned to myrmecophilum species group).
Comments
This species remains in Gryon based on its assignment to the myrmecophilum species group.
Gryon amplum
Hadronotus amplus Dodd, 1914b: 81 (original description); Dodd, 1915: 20 (keyed); Kieffer, 1926: 455, 471 (description, keyed).
Mirotelenomus amplus (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information).
Gryon amplum (Dodd): Caleca & Mineo, 1995: 19 (generic transfer).
Comments
The original description states “Head and thorax very finely reticulate rugulose” which is consistent with placement in Gryon if it is referring to microsculpture. However, it also states “club 6-jointed”, which suggests Hadronotus. Because it is presently unclear where this species belongs, we leave it in its current placement.
Gryon angustipenne
Telenomoides angustipennis Dodd, 1913a: 169, 171 (original description, keyed).
Hadronotus angustipennis (Dodd): Dodd, 1914a: 129 (generic transfer); Dodd, 1915: 20 (keyed); Kieffer, 1926: 456, 471 (description, keyed).
Mirotelenomus angustipennis (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information).
Gryon angustipenne (Dodd): Caleca & Mineo, 1995: 19 (generic transfer).
Comments
The holotype specimen has a 4-merous clava, the carina adjacent to the lateral pit on T1 is clearly visible, and the striation inside the axillar crescent is visible in the image of the right side. These characters, combined with the lack of macrosculpture on the head and dorsal mesosoma, enable us to confidently place this species in Gryon.
Gryon anna
Gryon anna Kozlov & Kononova, 1989: 80, 96 (original description, keyed); Kozlov & Kononova, 1990: 268, 298 (description); Johnson, 1992: 379 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 332, 428 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
Two characters from the original description suggest that this species belongs in Gryon: “Frontal depression not shallow, streaked with very fine arcuate wrinkles. The head is fine-grained.” and Figure
Gryon arabicum , comb. nov.
Breviscelio arabicus Caleca, 1990b: 140 (original description); Caleca, 1992: 52, 53 (type information, keyed).
Gryon ariantum
Gryon ariantum Kozlov & Kononova, 2004: 196 (original description); Kononova & Kozlov, 2008: 329, 402 (description, keyed).
Comments
We leave this species in Gryon until the type specimen can be examined directly. Figure
Gryon artum , comb. rev.
Mirotelenomus artus Kozlov, 1963a: 356 (english translation of original description, keyed); Kozlov, 1963b: 664 (original description, keyed); Szabó, 1966: 440 (description); Kozlov, 1978: 621 (description).
Exon artus (Kozlov): Masner, 1980: 22 (generic transfer); Kozlov & Kononova, 1990: 309 (description, keyed); Kononova & Petrov, 2002: 57 (keyed); Fabritius & Popovici, 2007: 41 (description).
Gryon artus (Kozlov): Mineo, 1980a: 200 (generic transfer).
Gryon artum (Kozlov): Mineo & Caleca, 1987b: 49 (emendation, keyed); Johnson, 1992: 379 (cataloged, type information); Mineo & Caleca, 1994: 122 (distribution).
Exon artum (Kozlov): Kononova & Kozlov, 2008: 447, 449 (description, keyed, generic transfer); Timokhov, 2019a: 15 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
Gryon austrafricanum
Gryon austrafricanum Mineo, 1979a: 236 (original description); Mineo & Caleca, 1987b: 47 (description of male); Mineo, 1990: 47 (distribution); Johnson, 1992: 379 (cataloged, type information).
Comments
The original description is largely inadequate for generic placement, but it states that the mandibles are bidentate, which is consistent with this as a species of Gryon.
Gryon brevipenne
Hadronotus brevipennis Harrington, 1900: 188 (original description); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 465 (description, keyed).
Gryon brevipennis (Harrington): Muesebeck & Masner, 1967: 299 (generic transfer); Sarazin, 1986: 973 (type information).
Gryon brevipenne (Harrington): Masner, 1983: 135, 166 (description, emendation, lectotype designation, keyed); Johnson, 1992: 380 (cataloged, type information).
Gryon brevium
Gryon brevior Kononova, 2005: 1358 (original description); Kononova, Pavlicek & Nevo, 2005: 816 (description).
Gryon brevius Kononova: Kononova & Kozlov, 2008: 328, 394 (description, keyed).
Comments
This species remains in Gryon based on images of the holotype specimen that illustrate the striate axillula, glabrous metapleuron, and subgenual spines on the hind tibia.
Gryon californicum , comb. rev.
Exon californicum Masner, 1980: 22 (original description).
Gryon californicum (Masner): Mineo & Caleca, 1987b: 49, 50 (generic transfer, keyed); Johnson, 1992: 380 (cataloged, type information).
Gryon callidum
Gryon callidum Kozlov & Kononova, 2004: 197 (original description); Kononova & Kozlov, 2008: 332, 430 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon caudatum
Gryon caudatum Kozlov & Kononova, 2004: 197 (original description); Kononova & Kozlov, 2008: 326, 373 (description, keyed).
Comments
This species remains in Gryon based on the abstract of
Gryon chrysolaum
Telenomus chrysolaus Walker, 1839: 80 (original description).
Hadronotus chrysolaus (Walker): Dodd, 1920a: 352 (generic transfer).
Liophanurus chrysolaus (Walker): Kieffer, 1926: 66, 84 (description, generic transfer, keyed).
Gryon chrysolaus (Walker): Masner, 1965: 75 (type information, generic transfer).
Gryon chrysolaum (Walker): Johnson, 1992: 381 (cataloged, type information).
Comments
The genus cannot be determined from the original description and examination of the primary type is required.
Gryon conicum
Gryon conicus Kozlov & Kononova, 1989: 79, 89 (original description, keyed); Kozlov & Kononova, 1990: 267, 282 (description, keyed); Kononova & Petrov, 2002: 55 (keyed).
Gryon conicum Kozlov & Kononova: Johnson, 1992: 381 (cataloged, type information); Kononova & Kozlov, 2008: 327, 381 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
This species remains in Gryon, largely because we cannot reliably determine its genus without examination of the type specimen. Our translation of the original description is as follows. “Frontal impression superficial, with very thin arcuate wrinkles. The head is fine-grained.” This is congruent with Gryon if the arcuate wrinkles refer to lines of microsculpture.
Gryon consocium
Gryon consocium Mineo, 1991: 20 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 119 (distribution).
Gryon coracinum
Synteleia coracina Fouts, 1927: 178 (original description).
Gryon coracinus (Fouts): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (type information).
Gryon coracinum (Fouts): Masner, 1983: 135, 172 (description, emendation, keyed); Johnson, 1992: 381 (cataloged, type information).
Gryon cornutum
Gryon cornutus Kononova & Petrov, 2001: 1471 (original description); Kononova & Petrov, 2002: 53 (keyed).
Gryon cornutum Kononova & Petrov: Kononova & Kozlov, 2008: 323, 349 (description, keyed).
Comments
This species remains in Gryon, albeit without great confidence, based on the original description: “Fine-grained head sculpture. The forehead has a well-defined frontal depression. The latter has a longitudinal carina, shining, with strongly smoothed grain.” Figure
Gryon crassifemoratum
Gryon crassifemoratum Mineo, 1990a: 181 (original description. Misspelled crasifemaratum in description, abstract; correct spelling (G. Mineo) in title); Johnson, 1992: 381 (cataloged, type information).
Comments
The original description for this species is woefully insufficient. We leave it in Gryon based on its placement in the myrmecophilum species group (Mineo 1990).
Gryon crenatum , comb. nov.
Breviscelio crenatus Sundholm, 1970: 383 (original description); Caleca, 1990b: 141 (description); Johnson, 1992: 355 (cataloged, type information); Caleca, 1992: 51, 53 (description, keyed).
Gryon cultratum , comb. nov.
Eremioscelio cultratus Kozlov, 1971: 49 (original description); Kozlov, 1972: 656 (keyed); Kozlov, 1978: 622 (description); Kozlov & Kononova, 1990: 311, 312 (description, keyed); Johnson, 1992: 373 (cataloged, type information); Kononova & Kozlov, 2008: 451, 453 (treated as valid species, description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
This synonymy of Eremioscelio with Gryon implicitly transfers this species. The transfer of Gryon cultratus Masner to Hadronotus means that homonomy is avoided.
Gryon cydnoide 29 holotype female (USNMENT01059665), head and mesosoma, anterior view 30 female (OSUC 395743) head, anterior view 31 holotype female (USNMENT01059665), habitus, dorsal view 32 female (OSUC 395739), habitus, dorsolateral view 33 holotype female, habitus, lateral view 34 mesosoma and T1, dorsolateral view.
Gryon moczari 35 female (CNC664036), head, anterior view 36 holotype female, head and mesosoma, lateral view 37 female (CNC664036), head and mesosoma, dorsolateral view 38 female (CNC664036), metasoma, dorsal view 39 female (CNC664036), antennal clava, ventrolateral view 40 female (CNC664036), wings, dorsal view.
Gryon crenatum 41 holotype female (
Gryon cydnoide , comb. rev.
Hadronotus bernardi Maneval, 1940: (original description); Mineo, 1991: 9 (name considered to be unavailable).
Eremioscelio cydnoides Priesner, 1951: 130 (original description); Kozlov, 1963a: 357 (description); Kozlov, 1963b: 666 (description); Kozlov, 1971: 49 (description); Kozlov, 1972: 656 (keyed); Kozlov, 1978: 62 (description); Mineo & Villa, 1982b: 134 (taxonomic value of structures on the posterior surface of the head); Mineo & Villa, 1982a: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Kozlov & Kononova, 1990: 311 (description, keyed); Johnson, 1992: 373 (cataloged); Notton, 2006: 195 (distribution); Fabritius & Popovici, 2007: 36, 39 (description, keyed); Kononova & Kozlov, 2008: 451, 452 (description, keyed, generic transfer).
Eremioscelio bernardi (Maneval): Masner, 1976: 59 (generic transfer, description); Mineo, 1991: 9 (junior synonym of Gryon cydnoide (Priesner)); Johnson, 1992: 373 (cataloged, type information).
Gryon cydnoide (Priesner): Mineo, 1991: 9 (generic transfer, synonymy); Mineo & Caleca, 1994: 126 (distribution); Timokhov, 2019a: 14 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon delucchii
Gryon delucchii Mineo & Szabó, 1978a: 88 (original description); Mineo & Gatto, 1981: 187 (description of preimaginal stages); Johnson, 1992: 381 (cataloged, type information); Kononova & Kozlov, 2008: 331, 425 (description, keyed).
Gryon dicaeum
Telenomus dicaeus Walker, 1839: 80 (original description).
Microphanurus dicaeus (Walker): Kieffer, 1926: 93, 109 (description, generic transfer, keyed).
Gryon dicaeus (Walker): Masner, 1965: 75 (type information, generic transfer).
Gryon dicaeum (Walker): Johnson, 1992: 381 (cataloged, type information).
Comments
We are unable to determine from the original description if this species belongs in Hadronotus or Gryon and leave its generic placement unchanged until examination of the type specimen occurs.
47 Encyrtoscelio (OSUC 334153), head, lateral view 48 Tyrannoscelio genieri Masner & Johnson (OSUC 545772), head and mesosoma, lateral view 49 Acanthoscelio (OSUC 232241), head, anterior view 50 Sparasion philippinensis (USNMENT00872835), head, anterior view.
Gryon californicum, paratype female (USNMENT01109308) 51 habitus, lateral view 52 head, anterior view 53 metasoma, dorsal view.
Gryon dichropterum
Gryon dichropterus Kozlov, 1966: 144 (original description); Mineo, 1980a: 191 (description of male); Johnson, 1992: 382 (cataloged, type information).
Eremioscelio dichropterus (Kozlov): Kozlov, 1972: 657 (generic transfer, keyed); Kozlov, 1978: 622 (description); Kozlov & Kononova, 1990: 311, 318 (description, keyed); Kononova & Kozlov, 2008: 452, 458 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon dichropterum Kozlov: Mineo & Caleca, 1994: 127, 128 (distribution, keyed).
Gryon dispar
Gryon dispar Kononova & Petrov, 2001: 1479 (original description); Kononova & Petrov, 2002: 57 (keyed); Kononova & Kozlov, 2008: 333, 436 (description, keyed).
Comments
We were not able to determine from the original description if this species belongs in Gryon or Hadronotus. Its placement thus remains unchanged.
Gryon aetherium 54 holotype female (USNMENT01335778), head, anterior view 55 female (
Gryon aetherium, female (USNMENT01109155), habitus, ventrolateral view.
Gryon elatior
Gryon elatior Masner, 1983: 135, 173 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 382 (cataloged, type information).
Gryon elongatum , comb. rev.
Gryon elongatum Mineo, 1991: 22 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 119 (distribution).
Gryon mineoi Özdikmen: Özdikmen, 2011: 772 (replacement name for Gryon elongatum Mineo).
Comments
The transfer of Hadronotus elongatus Risbec back to Hadronotus makes the replacement name no longer necessary for this species.
Gryon eremiogryon
Gryon eremiogryon Mineo, 1979a: 241 (original description); Mineo, 1979b: 96 (keyed); Johnson, 1992: 382 (cataloged); Kononova & Kozlov, 2008: 333, 440 (description, keyed).
Comments
The original description stated that G. eremiogryon has bidentate mandibles and the subsequent discussion expressed Mineo’s idea that G. eremiogryon was intermediate between Gryon and Eremioscelio. Given that the latter is now treated as a junior synonym of Gryon, we are fairly confident that this species belongs in Gryon.
Gryon aetherium 59 female (
Gryon aetherium, lateral habitus 67 female (
Gryon excertum
Gryon excertus Kononova & Fursov, 2005a: 595 (original description); Kononova & Fursov, 2005b: 304 (description).
Gryon excertum Kononova & Fursov: Kononova & Kozlov, 2008: 329, 409 (description, keyed).
Comments
The original and subsequent descriptions suggest the species should remain in Gryon, but it is not entirely clear: “The head sculpture is fine-meshed. Head with short, dense hairs arranged horizontally. The frontal depression above the antennae and the longitudinal frontal carina are absent. Fan-shaped wrinkles on cheeks.”
Gryon fasciatum
Hadronotus fasciatus Priesner, 1951: 130 (original description); Mineo, 1980b: 214 (type information).
Gryon fasciatus (Priesner): Kozlov, 1978: 619 (description, generic transfer); Kozlov & Kononova, 1989: 81 (keyed); Kozlov & Kononova, 1990: 269, 303 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Pintureau & al-Nabhan, 2003: 5 (new distribution record from France and Middle East (Syria)); Fabritius & Popovici, 2007: 15, 29 (description, keyed).
Gryon fasciatum (Priesner): Mineo, 1991: 23 (description, assigned to myrmecophilum species group); Johnson, 1992: 382 (cataloged, type information); Kononova & Kozlov, 2008: 332, 434 (description, keyed); Timokhov, 2019a: 15 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon firmum
Gryon firmum Mineo, 1991: 26 (original description, assigned to myrmecophilum species group).
Gryon flaviventre
Gryon flaviventris Kononova, 2001: 1469 (original description); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 14, 17 (description, keyed).
Gryon flaviventre Kononova: Kononova & Kozlov, 2008: 323, 345 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
This species remains in Gryon based on the original description, “The head sculpture is grainy. The frontal depression is weakly expressed, its sculpture is slightly smoothed” and Figure
Gryon fasciatum 73 holotype female (USNMENT01059667), habitus, dorsolateral view 74 paratype female (USNMENT01109130), habitus, lateral view 75 paratype female (USNMENT01109130), head and mesosoma ventral view 76 paratype female (USNMENT01109130), mesosoma, posterolateral view.
Gryon gonikopalense, holotype female (USNMENT01109129) 77 habitus, lateral view 78 mesosoma, lateral view.
Gryon flavum
Hadronotus flavus Dodd, 1913b: 172 (original description); Dodd, 1915: 18 (keyed); Kieffer, 1926: 455, 469 (description, keyed).
Gryon flavus (Dodd): Galloway, 1976: 91 (type information, generic transfer).
Gryon flavum (Dodd): Johnson, 1992: 383 (cataloged, type information).
Comments
The original description is insufficient for generic placement. We leave this species in Gryon and note that the holotype female needs to be examined.
Gryon fumosum
Hadronotus fumosus Dodd, 1914a: 130 (original description); Dodd, 1915: 20 (keyed); Kieffer, 1926: 455, 472 (description, keyed).
Mirotelenomus fumosus (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 109 (type information).
Gryon fumosus (Dodd): Galloway & Austin, 1984: 79 (generic transfer).
Gryon fumosum (Dodd): Mineo, 1990a: 180 (emendation, systematic position); Johnson, 1992: 383 (cataloged, type information).
Gryon fuscum
Gryon fuscus Kononova, 2001: 1477 (original description); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 29, 68 (keyed).
Gryon rutilator Kononova: Kononova & Kozlov, 2008: 328, 391 (replacement name, description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).
Comments
The original description lists a few characters that indicate that this species belongs in Gryon, “The head sculpture is fine-grained. Frontal depression not shiny, with strongly smoothed grain.” Plastogryon fuscus Dodd is now treated as a junior synonym of Hadronotus flavipes. The replacement name, Gryon rutilator Kononova, is thus no longer needed for this species.
Gryon gloriosum
Gryon gloriosum Kozlov & Kononova, 2004: 200 (original description); Kononova & Kozlov, 2008: 332, 425 (description, keyed).
Comments
We consider it most likely that this species belongs in Gryon based on the comparisons to G. hungaricum and G. laetum in the abstract of the original description.
Gryon goethei
Hadronotus goethei
Girault, 1932: 5 (original description); Galloway, 1976: 111 (type information, status uncertain); Gordh, Menke, Dahms & Hall, 1979: 297 (reprint of
Comments
The description of this species is insufficient for generic placement and examination of the holotype specimen is required.
Gryon gonikopalense
Gryon gonikopalensis Sharma, 1982: 327, 336 (original description, keyed).
Gryon gonikopalense Sharma: Johnson, 1992: 384 (cataloged).
Gryon gorines
Gryon gorines Kozlov & Lê, 1992: 210, 212, 221 (original description, assigned to misellum species group, keyed).
Gryon gorinis Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 116 (description, keyed, type information).
Gryon grande
Gryon grandis Kononova & Petrov, 2001: 1476 (original description); Kononova & Petrov, 2002: 55 (keyed).
Gryon grande Kononova & Petrov: Kononova & Kozlov, 2008: 327, 388 (description, keyed).
Comments
This species remains in Gryon based on the original description, “Head sculpture fine-grained. Frontal depression shallow, not wide, shining, with distinct longitudinal carina. Frons up to anterior ocellus with fine-grained sculpture” and Figure
Gryon grownum
Gryon grownum Kozlov & Lê, 1992: 212, 221 (original description, assigned to misellum species group, keyed).
Gryon grownus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 117 (description, keyed, type information).
Gryon gryonis
Gryon gryonis Mineo, 1990a: 172 (original description); Johnson, 1992: 384 (cataloged, type information).
Comments
The holotype specimen is very small, only about 0.7 mm in length, and is light in color. This makes it challenging to illustrate and interpret characters with brightfield photography. We believe that this species should remain in Gryon based on the apparently 4-merous clava, absence of transverse sculpture in the frontal depression, the glabrous metapleuron that is not dorsoventrally divided by sculpture or setation, and the presence of subgenual spines on the hind tibia (Figures
Gryon hospes
Plesiobaeus Hospes Kieffer, 1913: 283 (original description).
Plesiobaeus hospes Kieffer: Kieffer, 1926: 556 (description); Masner, 1965: 89 (type information); Kozlov, 1978: 621 (description); Kozlov & Kononova, 1990: 307 (description); Fabritius & Popovici, 2007: 34 (description); Kononova & Kozlov, 2008: 445 (description).
Gryon hospes (Kieffer): Mineo, 1979: 248 (description, generic transfer); Mineo & Caleca, 1987: 53 (description); Johnson, 1992: 384 (cataloged, type information).
Gryon howardi
Hadronotus howardi Mokrzecki & Ogloblin, 1931: 1 (original description); Masner, 1958: 42 (keyed); Loiácono & Díaz, 1996: 9 (type information).
Hadronotellus howardi (Mokrzecki & Ogloblin): Szabó, 1966: 422, 424 (description of male and female, generic transfer, keyed).
Gryon howardi (Mokrzecki & Ogloblin): Kozlov, 1978: 620 (description, generic transfer); Mineo, 1980a: 193 (description); Kozlov & Kononova, 1989: 78 (keyed); Kozlov & Kononova, 1990: 266, 271 (description, keyed); Johnson, 1992: 384 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 15, 22 (description, keyed); Kononova & Kozlov, 2008: 325, 366 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
Figure
Gryon hungaricum
Pannongryon hungaricum Szabó, 1966: 435, 436 (original description, keyed).
Gryon prolongatus
Kozlov, 1971: 48 (original description. Synonymized by
Gryon hungaricum (Szabó): Mineo, 1980a: 196 (generic transfer, synonymy); Mineo, 1991: 10, 12 (description, assigned to hungaricum species group, keyed); Johnson, 1992: 385 (cataloged, type information); Fabritius & Popovici, 2007: 30 (keyed).
Gryon prolongatum Kozlov: Kononova & Kozlov, 2008: 323, 348 (treated as valid species, keyed).
Comments
Gryon insidiosum
Gryon insidiosum Mineo, 1991: 27 (original description, assigned to myrmecophilum species group).
Gryon insulare , comb. nov.
Telenomoides insularis
Dodd, 1913a: 169, 171 (original description. Preoccupied by Hadronotus insularis
Hadronotus assimilis Dodd: Dodd, 1914a: 129 (replacement name, generic name); Dodd, 1915: 20 (keyed); Kieffer, 1926: 456, 472 (description, keyed).
Mirotelenomus assimilis (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information).
Gryon assimile (Dodd): Caleca & Mineo, 1995: 19 (generic transfer).
Comments
The 4-merous clava, shape of the clypeus, bidentate mandibles with large teeth, and fine sculpture of the head and dorsal mesosoma are visible in the slide mounted holotype female. Transfer of Hadronotus insularis Ashmead from Gryon back to Hadronotus makes the replacement species name “assimile” no longer necessary.
Gryon investe
Plastogryon investis
Kieffer, 1908: 143 (original description. Synonymized by
Plastogryon Investis Kieffer: Kieffer, 1913: 249 (description).
Plastogryon (Heterogryon) investis Kieffer: Kieffer, 1926: 446, 449 (description, subgeneric assignment, keyed).
Gryon investis (Kieffer): Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 277 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed).
Gryon investe (Kieffer): Kononova & Kozlov, 2008: 326, 377 (treated as valid species, description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
The treatment of Plastogryon investis as a junior synonym of Gryon misellum by
Gryon josephinae
Gryon Josephinae Mineo, 1991: 27 (original description, assigned to myrmecophilum species group).
Gryon josephinae Mineo: Mineo & Caleca, 1994: 119 (distribution).
Gryon justum
Gryon justus Kozlov & Kononova, 1989: 80, 93 (original description, keyed); Kozlov & Kononova, 1990: 268, 291 (description, keyed); Kononova & Petrov, 2002: 55 (keyed).
Gryon justum Kozlov & Kononova: Johnson, 1992: 385 (cataloged, type information); Kononova & Kozlov, 2008: 329, 404 (description, keyed).
Comments
This species remains in Gryon based on a character listed in the original description “The frontal impression is deep, not striate.”
Gryon kaszabi , comb. nov.
Eremioscelio kaszabi Mineo, 1979c: 269 (original description); Johnson, 1992: 373 (cataloged, type information).
Comments
Gryon elegans
Gryon elegans Kononova, 2001: 1478 (original description); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 331, 423 (description, keyed).
Gryon kononovai Özdikmen: Özdikmen, 2011: 771 (replacement name for Gryon elegans Kononova).
Comments
The original description provides some evidence for leaving this species in Gryon, “The head sculpture is fine-grained, resembles fine emery.” Our transfer of Plastogryon elegans Dodd to Hadronotus eliminates the need for the replacement name Gryon kononovai.
Gryon lada
Gryon lada Kozlov, 1972: 651 (original description); Kozlov & Kononova, 1989: 81 (keyed); Kozlov & Kononova, 1990: 269, 305 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 57 (keyed); Kononova & Kozlov, 2008: 333, 438 (description, keyed).
Gryon laetum
Gryon laetum Kozlov & Kononova, 2004: 201 (original description); Kononova & Kozlov, 2008: 332, 432 (description, keyed).
Comments
Figure
Gryon lala
Gryon lala Kozlov, 1972: 652 (original description); Mineo, 1980a: 197 (systematic relationships); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 288 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova, 1995: 84 (keyed); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 26, 66 (keyed); Kononova & Kozlov, 2008: 326, 376 (description, keyed).
Gryon lamia , comb. nov.
Eremioscelio lamia Kozlov, 1972: 655, 656 (original description, keyed); Kozlov & Kononova, 1990: 311, 315 (description, keyed); Johnson, 1992: 373 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Kozlov, 2008: 452, 455 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon largi
Hadronotus largi Ashmead, 1893: 230, 231 (original description); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 462 (description, keyed).
Gryon largi (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 35 (lectotype designation); Masner, 1983: 135, 169 (description, keyed); Johnson, 1992: 386 (cataloged, type information).
Gryon latum , comb. rev.
Mirotelenomus latus Kozlov, 1963a: 356 (English translation of original description, keyed); Kozlov, 1963b: 664 (original description, keyed, preoccupied by Austroscelio latus Dodd, 1916); Kozlov, 1978: 621 (description); Johnson, 1992: 392 (type information).
Gryon latus (Kozlov): Mineo, 1979a: 255 (generic transfer).
Exon latus (Kozlov): Masner, 1980: 22 (generic transfer); Kozlov & Kononova, 1990: 308, 309 (description, keyed); Kononova & Petrov, 2002: 57 (keyed).
Gryon latum (Kozlov): Mineo & Caleca, 1987b: 49, 50 (diagnosis, keyed).
Gryon kozlovi Mineo: Mineo, 1990a: 171 (unnecessarily proposed replacement name).
Exon latum (Kozlov): Kononova & Kozlov, 2008: 447 (description, keyed, generic transfer).
Comments
Our treatment of Exon as a junior synonym of Gryon implicitly transfers this species.
Gryon lena
Gryon lena Kozlov, 1972: 655 (original description); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 289 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova & Petrov, 2002: 55 (keyed); Kononova & Kozlov, 2008: 328, 398 (description, keyed).
Comments
This species remains in Gryon based on the redescription in Kozlov & Kononova (1990): “The frontal depression above the antennae is deep, with finely sculpted sculpture. The head sculpture is fine-grained.” However, we consider it necessary for the holotype specimen to be examined for confident placement.
Gryon longipenne
Platyteleia longipennis Dodd, 1913c: 335 (original description); Kieffer, 1926: 409 (description, keyed); Galloway, 1976: 101 (type information).
Gryon longipennis (Dodd): Galloway & Austin, 1984: 79 (generic transfer).
Gryon longipenne (Dodd): Mineo, 1990b: 58 (type information); Johnson, 1992: 387 (cataloged, type information).
Comments
Generic placement cannot be determined from the original description and examination of the holotype is needed.
Gryon lymantriae , comb. rev.
Hadronotus lymantriae Masner, 1958: 39, 42 (original description, keyed).
Gryon lymantriae (Masner): Masner, 1965: 77 (type information, generic transfer); Mineo, 1979a: 257 (description); Johnson, 1992: 387 (cataloged, type information); Mineo & Caleca, 1994: 127, 128 (distribution, keyed, synonymy).
Masneria lymantriae (Masner): Szabó, 1966: 442 (description of male and female, generic transfer).
Eremioscelio lymantriae (Masner): Kozlov, 1972: 657 (generic transfer, keyed); Kozlov, 1978: 622 (description); Livshits & Kuslitskii, 1989: 49 (keyed); Kozlov & Kononova, 1990: 311, 316 (description, keyed); Fabritius & Popovici, 2007: 36 (description, keyed); Kononova & Kozlov, 2008: 452, 456 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon maculatum
Gryon maculatum Kozlov & Kononova, 2004: 201 (original description); Kononova & Kozlov, 2008: 328, 400 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
The original description suggests that this species belongs in Gryon, but is not entirely clear, “The head is fine-grained. The second impression is distinct, with a longitudinal carina, in fine-grained ornamentation.”
Gryon magnum
Gryon magnus Kozlov & Kononova, 1989: 81, 99 (original description, keyed); Kozlov & Kononova, 1990: 269, 304 (description, keyed); Kononova & Petrov, 2002: 57 (keyed).
Gryon magnum Kozlov & Kononova: Johnson, 1992: 388 (cataloged, type information); Kononova & Kozlov, 2008: 333, 436 (description, keyed).
Comments
This species remains in Gryon based on the original description: “The frontal depression is shallow, with finer, significantly smoothed granularity. The forehead and the vertex are coarse-grained.”
Gryon marina
Gryon marina Kozlov & Kononova, 1989: 81, 97 (original description, keyed); Kozlov & Kononova, 1990: 269, 301 (description, keyed); Johnson, 1992: 388 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 332, 433 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
We consider it best to leave this species in Gryon based on characters in the original description, “The head is finely meshed” and “Cheeks from above in thin longitudinal wrinkles.”
Gryon medium
Gryon medius Kononova & Petrov, 2001: 1476 (original description); Kononova & Petrov, 2002: 55 (keyed).
Gryon medium Kononova & Petrov: Kononova & Kozlov, 2008: 327, 386 (description, keyed).
Comments
The original description illustrates a female antenna with four clavomeres and describes the sculpture of the frontal depression as “smoothed.”
Gryon menthes
Gryon menthes Kozlov & Lê, 1992: 220, 221 (original description, assigned to misellum species group, keyed).
Gryon menthis Kozlov & Lê, 1996: 9 (description); Lê, 2000: 96, 123 (description, keyed, type information).
Comments
Images of the paratype specimens show the presence of striation of the axillula and the lateral pit on T1.
Gryon micropterum
Hadronotus brevipennis
Kieffer, 1909: 270 (original description. Preoccupied by Hadronotus brevipennis
Hadronotus Micropterus (Kieffer): Kieffer, 1913: 244 (replacement name).
Hadronotus micropterus (Kieffer): Kieffer, 1926: 453, 457 (description, keyed); Bin, 1974: 455 (type information).
Gryon micropterus (Kieffer): Johnson, 1992: 388 (cataloged, type information).
Comments
The original description is insufficient for generic placement. We leave this species in its current placement until the holotype can be examined.
Gryon minutum
Gryon minimum
Mineo, 1990a: 173 (original description. Preoccupied by Hadronotus minimus
Gryon minutum Mineo: Mineo, 1991: 7 (replacement name for Gryon minimum Mineo, assigned to artum species group).
Gryon minimum
Hadronotus minimus Kieffer, 1908: 35 (original description); Kieffer, 1926: 455, 467 (description, keyed).
Gryon minimus (Kieffer): Alayo Dalmau, 1973: 99 (cataloged).
Gryon minimum (Kieffer): Johnson, 1992: 388 (cataloged).
Comments
The original description suggests that this species belongs in Gryon and so we leave it here for now, albeit without great confidence: “head wider than thorax, slightly arched back, twice as wide as long, smooth and shiny on the front which gives an unlimited frontal impression, finely chagrined on the rest.”
Gryon mirum
Gryon mirus Kononova & Petrov, 2001: 1477 (original description); Kononova & Petrov, 2002: 55 (keyed).
Gryon mirum Kononova & Petrov: Kononova & Kozlov, 2008: 327, 389 (description, keyed).
Comments
This species remains in Gryon based on the original description, “frontal impression with granular, strongly smoothed sculpture, shining.”
Gryon misellum
Gryon misellum Haliday, 1833: 271 (original description, keyed); Kieffer, 1926: 261 (description, keyed); Mineo, 1980a: 197 (variation); Masner, 1983: 135, 165 (description, keyed); Mineo & Caleca, 1987b: 44 (taxonomic status of Nearctic specimens); Mineo, 1990: 54 (distribution); Johnson, 1992: 388 (cataloged, type information); Mineo & Caleca, 1994: 120 (distribution); Pintureau & al-Nabhan, 2003: 2 (description, new distribution record from Portugal and France); Kononova & Kozlov, 2008: 326, 378 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Teleas pumilio
Nees von Esenbeck, 1834: 288 (original description. Synonymized by
Gryon misellus Haliday: Walker, 1836: 344 (description, emendation); Kieffer, 1908: 190 (description); Masner, 1961: 160 (description, synonymy, lectotype designation); Kozlov, 1963a: 357, 358 (description, keyed); Kozlov, 1963b: 667 (description, keyed); Hellén, 1971: 21 (description); Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 278 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 15, 26 (description, keyed).
Teleas misellus (Haliday): Blanchard, 1840: 290 (description, generic transfer).
Telenomus divisus
Wollaston, 1858: 25 (original description. Synonymized by
Acolus basalis
Thomson, 1859: 422 (original description. Synonymized by
Acolus opacus
Thomson, 1859: 422 (original description. Synonymized by
Gryon pumilio (Nees von Esenbeck): Mayr, 1879: 698 (generic transfer).
Plastogryon
Försteri Kieffer, 1908: 141 (original description. Synonymized by
Plastogryon pumilio (Nees von Esenbeck): Kieffer, 1908: 144 (generic transfer).
Plastogryon sagax
Kieffer, 1908: 142 (original description. Synonymized by
Plastogryon sagax var. brevipennis
Kieffer, 1908: 143 (original description. Synonymized by
Acoloides basalis (Thomson): Brues, 1908: 17 (diagnosis, list of species).
Acoloides opacus (Thomson): Brues, 1908: 17 (diagnosis, list of species).
Paragryon ? Misellus (Haliday): Kieffer, 1910: 99 (generic transfer).
Holacolus Basalis (Thomson): Kieffer, 1912: 107 (description, generic transfer).
Holacolus Opacus (Thomson): Kieffer, 1912: 107 (description, generic transfer).
Gryon Misellus Haliday: Kieffer, 1913: 214 (description).
Gryon Walkeri
Kieffer, 1913: 216 (original description. Synonymized by
Plastogryon Brevipennis Kieffer: Kieffer, 1913: 247 (description).
Plastogryon Pumilio (Nees von Esenbeck): Kieffer, 1913: 247 (description).
Plastogryon Sagax Kieffer: Kieffer, 1913: 249 (description).
Hadronotus divisus (Wollaston): Dodd, 1920a: 351 (generic transfer).
Gryon walkeri Kieffer: Kieffer, 1926: 261, 262 (description, keyed).
Holacolus basalis (Thomson): Kieffer, 1926: 170 (description, keyed).
Holacolus opacus (Thomson): Kieffer, 1926: 170 (description, keyed).
Plastogryon (Heterogryon) brevipennis Kieffer: Kieffer, 1926: 446, 448 (description, subgeneric assignment, keyed).
Plastogryon (Heterogryon) pumilio (Nees von Esenbeck): Kieffer, 1926: 446, 449 (description, subgeneric assignment, keyed).
Plastogryon (Heterogryon) sagax Kieffer: Kieffer, 1926: 446, 448 (description, subgeneric assignment, keyed).
Plastogryon (Plastogryon) foersteri Kieffer: Kieffer, 1926: 446, 447 (description, subgeneric assignment, keyed).
Gryon divisus (Wollaston): Masner, 1965: 75 (type information, generic transfer).
Gyron misellum Haliday: O’Connor, Nash, Notton & Fergusson, 2004: 25 (misspelling, catalog of Irish species).
Gryon moczari , comb. nov.
Hungarogryon moczari Szabó, 1966: 443 (original description); Kozlov, 1978: 621 (description); Mineo, 1979: 261 (figure); Kozlov & Kononova, 1990: 320 (keyed); Johnson, 1992: 402 (cataloged, type information); Mineo, 2005: 34 (new distribution record, host presumption); Kononova & Kozlov, 2008: 462 (description).
Comments
See generic synonymy.
Gryon monspeliense
Hadronotus monspeliensis Picard, 1924: 107 (original description).
Hadronotus afanasievi
Meier, 1949: (original description. reference from
Hadronotus afanassievi Meier: Ryakhovskii, 1959: 81 (description).
Hadronotus telengai
Ryakhovskii, 1959: 81, 84 (original description, keyed. Synonymized by
Gryon afanasievi (Meier): Kozlov, 1963c: 295, 296 (description).
Hadronotellus monspeliensis (Picard): Szabó, 1966: 423, 427 (description, generic transfer, keyed).
Gryon monspeliensis (Picard): Mineo, 1977: 82 (description of preimaginal stages); Kozlov, 1978: 619 (description, generic transfer); Mineo, 1979a: 258 (type information); Mineo, 1979b: 94 (keyed); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 299 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Fabritius & Popovici, 2007: 16, 32 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon laraichii Mineo: Mineo, 1979b: 94 (original description, keyed); Mineo, 1979a: 255 (description); Johnson, 1992: 386 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Kozlov, 2008: 429 (junior synonym of Gryon monspeliense (Picard)).
Gryon monspeliense (Picard): Johnson, 1992: 389 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Kozlov, 2008: 332, 429 (description, keyed, synonymy).
Gryon montanum
Hadronotus montanus Kieffer, 1906: 5 (original description).
Hadronotus ? montanus Kieffer: Kieffer, 1908: 145 (redescribed as new).
Psiloteleia montanus (Kieffer): Kieffer, 1926: 452 (description, keyed).
Gryon montanus (Kieffer): Mani & Sharma, 1982: 192 (generic transfer).
Gryon montanum (Kieffer): Johnson, 1992: 390 (cataloged).
Comments
Generic placement cannot be made from the original description. We leave this species in its current designation until the holotype specimen can be examined.
Gryon muscorum
Gryon muscorum Kozlov & Kononova, 2004: 202 (original description); Kononova & Kozlov, 2008: 327, 380 (description, keyed).
Comments
We were unable to determine the generic placement of this species, and thus it remains in Gryon until the holotype specimen can be examined.
Gryon myrmecophilum
Hadronotus myrmecophilus Ashmead, 1893: 230, 232 (original description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 462 (description, keyed).
Gryon myrmecophilus (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (type information).
Gryon myrmecophilum (Ashmead): Masner, 1983: 135, 170 (description, emendation, keyed); Johnson, 1992: 390 (cataloged, type information).
Gryon nigriceps
Hadronotus nigriceps Dodd, 1914b: 81 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 455, 469 (description, keyed).
Mirotelenomus nigriceps (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 109 (type information).
Gryon nigriceps (Dodd): Galloway & Austin, 1984: 79 (generic transfer); Johnson, 1992: 391 (cataloged, type information).
Comments
The head of the holotype male is slide-mounted and crushed. However, the distinctive shape of the clypeus found in Gryon and facial striae are visible on both sides of the head. The image of the dorsal meso- and metasoma shows the carina on T1 that is directly medial to the lateral pit that is diagnostic for Gryon, although the pit itself is not visible. This image also appears to show a subgenual spine on the right tibia.
Gryon nitens
Sundholmia nitens Szabó, 1966: 439 (original description. Synonymized by Mineo & Caleca (1987b)).
Gryon nitens (Szabó): Mineo, 1980a: 200 (generic transfer, description); Johnson, 1992: 392 (cataloged, type information).
Comments
Most of the diagnostic characters that place this species in Gryon are visible in the holotype but the specimen is not entirely clean. In lateral view, the subgenual spines are apparent and the metapleuron is not dorsoventrally divided by a change in sculpture or setation. In dorsal view, the striation is visible in the anterior portion of the axillar crescent and the foveae along the anterior margin of T1 are uniform in size, ending sublaterally in a carina. The lateral pit on T1 is obscured. The anterolateral view of the head illustrates that the frons does not have macrosculpture.
Gryon nosulcum
Gryon nosulcum Kozlov & Lê, 1992: 212, 221 (original description, assigned to misellum species group, keyed).
Gryon nosulcus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 128 (description, keyed, type information).
Gryon obscurum
Gryon obscurum Mineo, 1991: 27 (original description, assigned to myrmecophilum species group).
Gryon oligomerum
Gryon oligomerum Kononova: Kononova, Pavlicek & Nevo, 2005: 816 (description); Kononova, Pavlicek & Nevo, 2005: 1358 (original description); Kononova & Kozlov, 2008: 329, 406 (description, keyed).
Comments
Figures
Gryon paradigma
Gryon paradigma Mineo, 1991: 29 (original description, assigned to myrmecophilum species group).
Comments
Females of this species have 11 antennomeres. Figure
Gryon parafasciatum
Gryon parafasciatum Mineo, 1991: 30 (original description, assigned to myrmecophilum species group).
Gryon parkeri
Hadronotus parkeri Fouts, 1920: 64 (original description).
Gryon parkeri (Fouts): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (type information); Masner, 1983: 135, 167 (description, keyed); Johnson, 1992: 393 (cataloged, type information).
Gryon patroclus
Gryon patroclus Mineo, 1994: 119 (original description, assigned to myrmecophilum group).
Gryon pedestre
Teleas pedestris Nees von Esenbeck, 1834: 293 (original description); Graham, 1988: 33 (publication of drawing by Westwood of Nees’s specimen, generic transfer. This change in interpretation of Teleas pedestris may negate some or all of the reported synonymies).
Platygaster apterus Nees von Esenbeck, 1834: 299 (original description); Kononova & Kozlov, 2001: 284 (junior synonym of Trimorus pedestris (Nees von Esenbeck)).
Prosacantha pedestris (Nees von Esenbeck): Thomson, 1859: 431 (description, generic transfer).
Prosacantha subtilis
Thomson, 1859: 430 (original description. Synonymized by
Hoplogryon Subtilis (Thomson): Kieffer, 1908: 210 (generic transfer, keyed).
Hoplogryon pedestris (Nees von Esenbeck): Kieffer, 1908: 202, 212 (generic transfer, keyed).
Hoplogryon (Hoplogryon) pedestris (Nees von Esenbeck): Kieffer, 1910: 97 (subgeneric assignment); Kieffer, 1926: 183, 186, 189 (description, keyed).
Hoplogryon (Hoplogryon) subtilis (Thomson): Kieffer, 1910: 98 (subgeneric assignment); Kieffer, 1926: 186, 201 (description, keyed).
Hoplogryon Pedestris (Nees von Esenbeck): Kieffer, 1912: 114, 151 (description).
Hoplogryon subtilis (Thomson): Kieffer, 1912: 144 (description).
Hadronotellus pedester Kieffer, 1917: 341 (original description); Szabó, 1966: 423, 425 (description, type information, keyed); Hellén, 1971: 23 (description).
Hadronotus pedester (Kieffer): Kieffer, 1926: 453, 456 (generic transfer, description, keyed); Meier, 1940: 80 (description, keyed); Ryakhovskii, 1959: 81 (keyed).
Platygaster aptera Nees von Esenbeck: Kieffer, 1926: 826 (description, emendation); Vlug, 1995: 48 (cataloged).
Trimorus pedestris
(Nees von Esenbeck): Szabó, 1966: 25, 46 (description, synonymy, keyed); Fabritius, 1969: 271 (description); Kozlov, 1978: 625 (description); Kononova & Kozlov, 2001: 160, 165, 284 (description, keyed, no mention of generic transfer by
Trimorus subtilis (Thomson): Sundholm, 1967: 133 (lectotype designation, generic transfer).
Gryon pedester (Kieffer): Mineo, 1979b: 96 (keyed).
Gryon pedestre (Nees von Esenbeck): Johnson, 1992: 393 (cataloged); Johnson, 1992: 394 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Buhl, 1997: 42 (description); Fabritius & Popovici, 2007: 14, 18 (description, keyed).
Gryon krygeri Buhl: Buhl, 1997: 41 (replacement name for Hadronotellus pedester Kieffer, preoccupied by Teleas pedestris Nees von Esenbeck, junior synonym of Gryon pedestre (Nees von Esenbeck)).
Gryon pisus
Hadronotus pisus Nixon, 1934b: 292, 297 (original description, keyed); Risbec, 1950: 592, 593, 638 (description, variation, keyed).
Hadronotus Basilewskyi Risbec, 1957: 140 (original description).
Gryon pisus (Nixon): Masner, 1965: 78 (type information, generic transfer).
Gryon basilewskyi (Risbec): Masner, 1976: 58 (generic transfer, systematic position); Johnson, 1992: 379 (cataloged, type information).
Gryon pisum (Nixon): Mineo, 1991: 32 (emendation, description, synonymy, assigned to myrmecophilum species group); Johnson, 1992: 394 (cataloged, type information).
Hadronotus basilewskyi Risbec: Mineo, 1991: 32 (junior synonym of Gryon pisum (Nixon)).
Comments
This species was named after Pisus, son of Aphraeus, a character from Greek mythology, and thus the species epithet should be treated as an appositional noun.
Gryon politum
Hadronotus politus Ashmead, 1894: 229, 230 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 466 (description, keyed).
Gryon politus (Ashmead): Masner, 1976: 58 (generic transfer, type information).
Gryon politum (Ashmead): Johnson, 1992: 394 (cataloged, type information).
Comments
The original description is insufficient for placing this species, and we leave it under its current generic assignment.
Gryon prisma
Gryon prisma Mineo, 1991: 34 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 120 (distribution).
Gryon psilantere
Gryon psilantere Kozlov & Lê, 1992: 213, 221 (original description, assigned to misellum species group, keyed).
Gryon psilanteris Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 130 (description, keyed, type information).
Gryon rectum
Gryon rectus Kozlov & Kononova, 1989: 80, 95 (original description, keyed); Kozlov & Kononova, 1990: 268, 297 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Fabritius & Popovici, 2007: 16, 31 (description, keyed).
Gryon rectum Kozlov & Kononova: Johnson, 1992: 395 (cataloged, type information); Kononova & Kozlov, 2008: 332, 427 (description, keyed).
Comments
The original description does not list any characters that would exclude this species from Gryon, but confident determination will require examination of the holotype.
Gryon regulare
Gryon regularis Kozlov & Kononova, 1989: 80, 92 (original description, keyed); Kozlov & Kononova, 1990: 268, 290 (description, keyed); Kononova & Petrov, 2002: 55 (keyed).
Gryon regulare Kozlov & Kononova: Johnson, 1992: 395 (cataloged, type information); Kononova & Kozlov, 2008: 329, 401 (description, keyed).
Comments
The original description is consistent with placement of this species in Gryon, especially the following “Cheeks from above are thinly striated longitudinally”. However, examination of the type specimen is needed.
Gryon remotum
Gryon remotum Mineo, 1991: 35 (original description, assigned to myrmecophilum species group).
Gryon rubrigaster
Pannongryon rubrigaster Szabó, 1966: 435, 437 (original description, keyed).
Gryon rubrigaster (Szabó): Mineo, 1979a: 261 (generic transfer, type information); Mineo & Szabó, 1979: 272 (description of male); Mineo, 1991: 36 (description, assigned to myrmecophilum species group); Johnson, 1992: 395 (cataloged, type information); Mineo & Caleca, 1994: 120 (distribution); Kononova & Kozlov, 2008: 322, 338 (description, keyed).
Gryon rubrum
Gryon rubrum Kononova & Petrov, 2001: 1470 (original description); Kononova & Petrov, 2002: 53 (keyed); Kononova & Kozlov, 2008: 323, 346 (description, keyed).
Comments
The original description refers to the head sculpture as “fine-grained, strongly smoothed” and provides no characters that would lead us to remove it from Gryon.
Gryon rubtzovi
Hadronotus rubtzovi Ryakhovskii, 1959: 81 (original description).
Gryon rubtzovi (Ryakhovskii): Kozlov, 1963a: 358 (description, generic transfer, lectotype designation, keyed); Kozlov, 1963b: 667, 668 (description, keyed, generic transfer, lectotype designation); Johnson, 1992: 395 (cataloged, type information); Mineo & Caleca, 1994: 127 (junior synonym of Gryon lymantriae (Masner)); Kononova & Petrov, 2002: 55 (keyed); Kononova & Kozlov, 2008: 328, 392 (treated as valid species, description, keyed, synonymy).
Gryon rubtzovi
Kozlov & Kononova, 1989: 78, 86 (original description, keyed. An objective junior synonym of Hadronotus rubtzovi
Gryon rufescens
Gryon rufescens Kozlov & Kononova, 2004: 206 (original description); Kononova & Kozlov, 2008: 328, 393 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).
Comments
Our translation of the original description, and the illustrations provided therein, are not sufficient for us to determine the generic placement of this species. Therefore, we leave it in Gryon.
Gryon simile
Gryon similis Kozlov & Kononova, 1989: 79, 88 (original description, keyed); Kozlov & Kononova, 1990: 267, 279 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed).
Gryon simile Kozlov & Kononova: Johnson, 1992: 396 (cataloged, type information); Kononova & Kozlov, 2008: 326, 378 (description, keyed).
Gryon solutum
Gryon solutus Kononova, 2001: 1472 (original description); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 15, 21 (description, keyed).
Gryon solutum Kononova: Kononova & Kozlov, 2008: 323, 350 (description, keyed).
Comments
We leave this species in Gryon based on the original description, “The head sculpture is fine-grained. The frontal impression is distinct, its sculpture is slightly smoothed.”
Gryon sparsum
Gryon sparsum Kozlov & Kononova, 2004: 207 (original description); Kononova & Kozlov, 2008: 328, 397 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).
Comments
The illustrations in the original description are consistent with placement with Gryon. We thus choose to leave it in this genus until direct examination of the holotype can occur.
Gryon spennum
Gryon spennum Kozlov & Lê, 1992: 212, 221 (original description, assigned to misellum species group, keyed).
Gryon spennus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 131 (description, keyed, type information).
Gryon striatum , comb. nov.
Breviscelio striatus Caleca, 1992: 49, 52 (original description, keyed).
Gryon subfasciatum
Telenomus subfasciatus Wollaston, 1858: 25 (original description); Kieffer, 1926: 40 (description).
Hadronotus subfasciatus (Wollaston): Dodd, 1920a: 350 (generic transfer).
Gryon subfasciatus (Wollaston): Masner, 1965: 78 (type information, generic transfer); Mineo, 1980a: 201 (description).
Gryon subfasciatum (Wollaston): Graham, 1984: 99 (emendation); Johnson, 1992: 396 (cataloged, type information).
Comments
Neither the original description nor the redescription by
Gryon szaboi
Hadronotellus hungaricus Szabó, 1966: 422, 423 (original description, keyed).
Gryon hungaricus (Szabó): Kozlov, 1978: 619 (description, generic transfer); Mineo, 1979a: 250 (variation); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 292 (description, keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 16 (keyed).
Gryon szaboi Mineo: Mineo, 1991: 11, 12 (replacement name for Hadronotellus hungaricus Szabó, description, assigned to hungaricum species group, keyed); Mineo & Caleca, 1994: 120 (distribution).
Gryon hungaricum (Szabó): Johnson, 1992: 385 (cataloged, type information); Kozlov & Kononova, 2008: 329, 403 (description, keyed).
Comments
We leave this species in Gryon based on
Gryon szelenyii
Pannongryon szelenyii Szabó, 1966: 435 (original description, keyed).
Gryon szelenyii (Szabó): Kozlov, 1971: 48, 49 (diagnosis, generic transfer); Kozlov, 1978: 620 (description); Mineo & Szabó, 1978a: 93 (description); Mineo, 1980a: 196 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 288 (description, keyed); Johnson, 1992: 397 (cataloged, type information); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 26, 66 (keyed); Kononova & Kozlov, 2008: 326, 375 (description, keyed).
Pannongryon szelenyi Szabó: Mineo, 1991: 38 (misspelling).
Gryon szeleneyi (Szabó): Mineo, 1991: 38 (description, assigned to myrmecophilum species group, misspelling).
Gryon tardum
Gryon tardus Kononova & Fursov: Kononova & Fursov, 2005a: 593 (original description); Kononova & Fursov, 2005b: 303 (description).
Gryon tardum Kononova & Fursov: Kononova & Kozlov, 2008: 330, 410 (description, keyed).
Comments
This species remains Gryon based on the original description “Frontal depression shallow, smooth, shining, with distinct longitudinal carina, almost reaching the anterior ocellus,” and Figure
Gryon tauricum
Gryon tauricus Kozlov & Kononova, 1989: 80, 93 (original description, keyed); Kononova & Petrov, 2002: 55 (keyed).
Gryon tauricum Kozlov & Kononova: Kononova & Kozlov, 2008: 329, 405 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
This species remains Gryon based on the original description.
Gryon tiliarum , comb. nov.
Exon tiliarum Kononova & Petrov, 2002: 57 (original description, keyed); Kononova & Kozlov, 2008: 447, 450 (description, keyed, generic transfer).
Gryon thema
Gryon thema Mineo, 1991: 38 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 120 (distribution).
Gryon tobiasi
Gryon tobiasi Kozlov & Kononova, 2004: 207 (original description); Kononova & Kozlov, 2008: 327, 387 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).
Gryon triangulum
Gryon triangulum Masner, 1983: 135, 171 (original description, keyed); Sarazin, 1986: 979 (type information); Johnson, 1992: 397 (cataloged, type information).
Gryon trjapitzini
Gryon trjapitzini Kozlov & Kononova, 1989: 79, 90 (original description, keyed); Kozlov & Kononova, 1990: 267, 283 (description, keyed); Johnson, 1992: 397 (cataloged, type information); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 29, 68 (keyed); Kononova & Kozlov, 2008: 327, 384 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia).
Comments
This species remains in Gryon based on characters in the original description, “Frontal depression shallow, smooth, mirror-shiny. The head is fine-grained.”
Gryon turcicum
Gryon turcicus Kononova & Petrov, 2001: 1471 (original description); Kononova & Petrov, 2002: 53 (keyed).
Gryon turcicum Kononova & Petrov: Kononova & Kozlov, 2008: 323, 347 (description, keyed).
Comments
The original description of this species is very short and states that the surface sculpture of the head and mesosoma is like that of Gryon rubrum.
Gryon ukrainicum , comb. nov.
Eremioscelio ukrainica Kozlov & Kononova, 1990: 311, 314 (original description, keyed); Johnson, 1992: 373 (cataloged, type information); Fabritius & Popovici, 2007: 36, 40 (description, keyed).
Eremioscelio ukrainicus Kozlov & Kononova: Kononova & Kozlov, 2008: 452, 453 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon valeria , nom. n.
Eremioscelio tauricus Kozlov & Kononova, 1990: 311, 317 (original description, keyed); Johnson, 1992: 373 (cataloged, type information); Fabritius & Popovici, 2007: 36, 38 (description, keyed); Kononova & Kozlov, 2008: 452, 457 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
We transfer this species to Gryon based on its prior placement in Eremioscelio, which results in homonymy with Gryon tauricum Kozlov & Kononova (1989). We here provide a euphonic replacement name, “valeria”, to be treated as a noun in apposition.
Gryon verum
Gryon verus Kozlov & Kononova, 1989: 79, 91 (original description, keyed); Kozlov & Kononova, 1990: 267, 284 (description, keyed); Kononova & Petrov, 2002: 54 (keyed).
Gryon verum Kozlov & Kononova: Johnson, 1992: 398 (cataloged, type information); Kononova & Kozlov, 2008: 326, 372 (description, keyed).
Comments
The description from Kozlov & Kononova (1990) stated, “The frontal impression above the antenna is deep, the granularity of the impression is well pronounced.” No mention of transverse striae supports leaving this species in Gryon, but examination of the holotype is needed for confident placement.
Gryon xanthogaster
Acolus xanthogaster Ashmead, 1893: 174 (original description).
Psilacolus xanthogaster (Ashmead): Kieffer, 1910: 101 (generic transfer); Kieffer, 1926: 152, 153 (description, keyed).
Acoloides xanthogaster (Ashmead): Muesebeck & Walkley, 1951: 696 (generic transfer).
Gryon xanthogaster (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 37 (type information); Masner, 1983: 133, 163 (description, keyed); Johnson, 1992: 398 (cataloged, type information).
Comments
We suspect that the concept of G. xanthogaster from
Gryon xanthogaster 83 holotype female (USNMENT00989056), head and mesosoma, lateral view 84 holotype female (USNMENT00989056), head, anterior view 85 holotype female (USNMENT00989056), head and mesosoma, dorsal view 86 female (
Hadronotus
Hadronotus
Förster, 1856 stat. rev.: 101, 105 (original description. Type: Hadronotus exsculptus Förster, first included species, keyed. Synonymized by
Muscidea
Motschoulsky, 1863 syn. n.: 70 (original description. Type: Muscidea pubescens Motschoulsky, by monotypy. Synonymized by
Hadronotoides Dodd, 1913b syn. n.: 171 (original description. Type: Hadronotus pentatomus Dodd, by monotypy and original designation. Treated as junior synonym of Gryon by Caleca (1990)); Kieffer, 1926: 266, 474 (description, keyed, key to species); Brues, 1940: 81 (description); Mani, 1941: 19, 27 (catalog of species of India, keyed); Muesebeck & Walkley, 1956: 357 (citation of type species); Masner, 1976: 7, 59 (description, keyed); Mani & Sharma, 1982: 151 (keyed); Mineo & Villa, 1982b: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 139 (taxonomic value of structures on the posterior surface of the head); Galloway & Austin, 1984: 6, 81 (diagnosis, list of species described from Australia, keyed); Johnson, 1992: 398 (cataloged, catalog of world species); Carpenter, 1992: 471 (fossil references).
Platyteleia Dodd, 1913a syn. n.: 131, 153 (original description. Type: Platyteleia latipennis Dodd, by monotypy and original designation); Dodd, 1914b: 79 (description); Kieffer, 1926: 269, 408 (description, keyed, key to species); Muesebeck & Walkley, 1956: 386 (citation of type species); Masner, 1958: 42 (status of subgenera, delimitation of species groups); Masner, 1961: 158 (junior synonym of Gryon Haliday); Szabó, 1966: 421, 429 (description, key to Palearctic species known to the author, keyed); Baltazar, 1966: 182 (cataloged, catalog of species of the Philippines); Hellén, 1971: 5, 22 (description, keyed); Galloway & Austin, 1984: 78 (junior synonym of Gryon Haliday); Carpenter, 1992: 471 (fossil references).
Telenomoides
Dodd, 1913a syn. n. : 158, 168 (original description. Type: Telenomoides flavipes Dodd, by original designation. Key to species of Australia, keyed); Muesebeck & Walkley, 1956: 402 (citation of type species). Comments.
Notilena Brèthes, 1913 syn. n.: 84 (original description. Type: Notilena Gallardoi Brèthes, by monotypy and original designation); Muesebeck & Walkley, 1956: 375 (citation of type species); De Santis & Esquivel, 1966: 96 (junior synonym of Gryon Haliday). Comments. We remove Notilena from Gryon and treat it as a synonym of Hadronotus based on characters in the original description, “Capite punctato-umbilicato, facie longitrorsum impressa, utrinque transverse striata et in medio antennas versus longitrorsum cristata,” which we interpret to indicate that the sculpture of the head is punctate-umbilicate and that the antennal scrobe has transverse striation.
Austroscelio Dodd, 1914c syn. n.: 93 (original description. Type: Sparasion nigricoxa Dodd, by original designation. Synonymized by Galloway, in Galloway & Austin (1984)); Kieffer, 1926: 266, 473 (description, keyed, key to species); Muesebeck & Walkley, 1956: 334 (citation of type species); Galloway & Austin, 1984: 78 (junior synonym of Gryon Haliday).
Hadrophanurus
Kieffer, 1926 syn. n.: 15, 130 (original description. Type: Telenomus pennsylvanicus Ashmead, by monotypy, keyed. Synonymized by
Diagnosis
Sculpture of head and mesosoma highly variable, ranging from coriaceous microsculpture to coarsely areolate or rugose; mandibular dentition variable, teeth of unequal size; clypeus not projecting; ventral frons without facial striae; antennal scrobe with macrosculpture ranging from transversely striate to areolate rugose; antennal scrobe often delimited by carinae; female antenna with 10 flagellomeres, four to seven clavomeres; sculpture of mesoscutum and mesoscutellum variable, ranging from coriaceous microsculpture to coarsely areolate, striate or rugose; epomial carina variable, sometimes extending dorsally to pronotal shoulder; netrion absent; mesoscutal humeral sulcus and mesoscutal suprahumeral sulcus variable: absent or indicated by a furrow or line of foveae; mesoscutum with or without humeral pit; sculpture of axillula variable, sometimes with parallel carina between coarse foveae, but not distinctly striate; metapleuron divided dorsoventrally by a change in sculpture or setation; hind tibia without subgenual spines; foveae along anterior T1 decreasing in size laterally, not bordered laterally by a carina or pit.
Comments. Hadronotus is morphologically variable and to our knowledge is not united by any single character.
Species of Hadronotus
Hadronotus achille , comb. nov.
Gryon achille Mineo, 1992: 25 (original description).
Hadronotus aculeator , comb. nov.
Gryon aculeator Masner, 1983: 157 (original description); Johnson, 1992: 378 (cataloged, type information).
Hadronotus aculus , comb. nov.
Gryon aculum Mineo, 1991: 2 (original description, assigned to aculum species group).
Hadronotus acuteangulatus , comb. nov.
Gryon acuteangulatum Mineo, 1991: 3 (original description, assigned to acuteangulatum species group).
Comments
We transfer this species based the paratype specimen that we examined as well as characters and Figures
Hadronotus acutiventris , comb. nov.
Gryon acutiventre Masner, 1983: 134, 158 (original description, keyed); Johnson, 1992: 378 (cataloged, type information).
Hadronotus agamennone , comb. nov.
Gryon agamennone Mineo, 1992: 26 (original description)
Comments
We transfer this species based on a paratype specimen and the original description, “...frontal depression that is striated for not more than ⅔, the remaining being smooth and shiny,” and because it was considered by
Hadronotus agilis , comb. rev.
Hadronotus agilis Ashmead, 1896: 799 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 466 (description, keyed).
Gryon agilis (Ashmead): Masner, 1965: 74 (type information, generic transfer); Masner, 1976: 58 (description).
Gryon agile (Ashmead): Johnson, 1992: 378 (cataloged, type information).
Comments
We transfer this species back to Hadronotus based on the original description of the sculpture as “coarsely rugose.”
Hadronotus alames , comb. nov.
Gryon alames Kozlov & Lê, 1992: 233, 237 (original description, assigned to muscaeforme species group, keyed); Kozlov & Lê, 1996: 12 (description); Lê, 2000: 100 (description, keyed, type information).
Hadronotus allanidoddi , comb. nov.
Plastogryon flavipes
Dodd, 1914a: 125 (original description. Preoccupied by Telenomoides flavipes
Plastogryon (Heterogryon) flavipes Dodd: Kieffer, 1926: 446, 451 (description, subgeneric assignment, keyed).
Gryon flavipes (Dodd): Galloway, 1976: 91 (type information, generic transfer); Johnson, 1992: 383 (cataloged, type information).
Gryon allanidoddi Mineo: Mineo, 1990b: 55 (replacement name for Plastogryon flavipes Dodd, description).
Hadronotus ambericus , comb. nov.
Gryon ambericum Peter & Rajmohana, 2014: 6711 (original description, diagnosis, placed in leptocorisae species group).
Comments
Our transfer of this species to Hadronotus is based on images provided in the original description.
Hadronotus amerares , comb. nov.
Gryon amerares Kozlov & Lê, 1992: 230, 237 (original description, assigned to muscaeforme species group, keyed).
Gryon ameraris Kozlov & Lê, 1996: 11 (description); Lê, 2000: 99, 101 (description, keyed, type information).
Hadronotus americanus , comb. nov.
Gryon americanum Mineo, Mineo & Caleca,1994: 130 (original description)
Comments
We transfer this species based on the original description, “frontal depression deep and large, crossed by dense and parallel transverse striae.”
Hadronotus amissus , comb. nov.
Gryon amissus Kozlov & Kononova, 1989: 87 (original description, keyed); Kozlov & Kononova, 1989: 266, 276 (description, keyed).
Gryon amissum Kozlov & Kononova: Kononova & Kozlov, 2008: 324, 351 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
We transfer this species based on the original description, “Frontal depression above antennae well pronounced, transversely striated.”
Hadronotus amitto , comb. nov.
Gryon amitto Kozlov & Kononova, 1989: 87 (original description, keyed).
Comments
We transfer this species based on the original description, “Frontal depression above antennae well pronounced, transversely striated.”
Hadronotus anasae , comb. rev.
Telenomus anasae Ashmead, 1887: 23 (original description).
Hadronotus rugosus
Howard, 1889: 242 (original description. Synonymized by
Hadronotus anasae (Ashmead): Ashmead, 1893: 231, 233 (generic transfer, description, keyed); Brues, 1910: 47 (keyed); Brues, 1916: 555 (description); Kieffer, 1926: 454, 464 (description, keyed).
Gryon anasae (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (lectotype designation); Masner, 1983: 134, 139 (description, synonymy, keyed); Mineo & Caleca, 1987a: 32 (description); Johnson, 1992: 378 (cataloged, type information).
Gryon rugosus (Howard): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (lectotype designation).
Gryon rugosum (Howard): Mineo & Caleca, 1987a: 34 (description).
Hadronotus ancinla , comb. nov.
Gryon ancinla Kozlov & Lê, 1992: 236, 238 (original description, assigned to muscaeforme species group, keyed); Kozlov & Lê, 1996: 11 (description); Lê, 2000: 98, 102 (description, keyed, type information).
Gryon clavaerum Kozlov & Lê, 1992: 233, 237 (original description, assigned to muscaeforme species group, keyed).
Gryon clavaerus
Kozlov & Lê, 1996: 12 (description); Lê, 2000: 99, 108 (description, keyed, type information);
Hadronotus anserculus , comb. nov.
Gryon anserculum Mineo, 1991: 7 (original description, assigned to aureum species group).
Hadronotus apex , comb. nov.
Gryon apex Kozlov & Kononova, 2004: 195 (original description); Kononova & Kozlov, 2008: 324, 358 (description, keyed).
Hadronotus argus , comb. nov.
Gryon argus Kononova, 2005: 1353 (original description)
Comments
From the original description, “The frontal indentation is superficial, not bordered by an arcuate keel, in transverse wrinkles, with a distinct longitudinal keel.” The summary of the original publication, written in English, states that “Gryon argus is similar to G. coronatum, Kononova, but differs in abdomen proportions.” Illustrations in the original description of G. coronotum depict a frontal depression that enables us to place that species in Hadronotus. It is on this basis and the presence of “transverse wrinkles” in the frontal depression that we make the generic transfer.
Hadronotus artus , comb. nov.
Gryon artus Kozlov & Kononova, 1989; 81, 99 (original description); Kozlov & Kononova, 1990: 306 (description, keyed); Johnson, 1992: 379 (catalogued); Kononova & Kozlov, 2008: 333, 439 (description, keyed).
Comments
Mirotelenomus artus Kozlov was transferred to Exon by
Hadronotus atrocoxalis , comb. rev.
Hadronotus atrocoxalis Ashmead, 1896: 799 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 466 (description, keyed).
Gryon atrocoxalis (Ashmead): Masner, 1965: 74 (type information); Masner, 1976: 58 (description, systematic position); Masner, 1979: 792, 794 (description, keyed).
Gryon atrocoxale (Ashmead): Johnson, 1992: 379 (cataloged, type information).
Comments
The original description indicates that this species is rugose, and separately states “Abdomen rugose”, leading us to believe that the former refers to the head or mesosoma.
Hadronotus ater , comb. nov.
Gryon atrum Masner, 1983: 135, 139 (original description, keyed); Sarazin, 1986: 972 (type information); Johnson, 1992: 379 (cataloged, type information).
Hadronotus aureus , comb. nov.
Plastogryon aureus Dodd, 1914f: 256 (original description); Dodd, 1915: 24 (keyed).
Plastogryon (Heterogryon) aureus Dodd: Kieffer, 1926: 447, 450 (description, subgeneric assignment, keyed).
Gryon aureus (Dodd): Galloway, 1976: 91 (type information, generic transfer).
Gryon aureum (Dodd): Mineo, 1991: 7 (assigned to aureum species group); Johnson, 1992: 379 (cataloged, type information).
Comments
The original description is insufficient to determine if this species belongs in Gryon or Hadronotus.
Hadronotus austini , comb. nov.
Gryon austini Mineo, 1991: 6 (original description, assigned to acuteangulatum species group).
Comments
The transfer to Hadronotus is based on examination of a paratype specimen and characters in the original description: mandibles tridentate, striae present above the frontal depression, and frons sculptured with irregular polygons.
Hadronotus australicus , comb. nov.
Sparasion nigricoxa
Dodd, 1914a: 123 (original description. Preoccupied by Gryon nigricoxa (
Austroscelio nigricoxa (Dodd): Dodd, 1914c: 93 (description, generic transfer, synonymy); Kieffer, 1926: 473 (description, keyed); Galloway, 1976: 85 (type information).
Sparaison australicum
Dodd, 1914f: 255 (original description, spelling error. Synonymized by
Sparasion australicum Dodd: Dodd, 1914c: 93 (junior synonym of Austroscelio nigricoxa (Dodd)).
Sparasion australicus Dodd: Kieffer, 1926: 299 (description, emendation).
Austroscelio australicum (Dodd): Galloway, 1976: 85 (type information).
Gryon nigricoxa (Dodd): Galloway & Austin, 1984: 80 (generic transfer); Johnson, 1992: 391 (cataloged, type information).
Gryon australicum Mineo: Mineo, 1990b: 52 (replacement name for Sparasion nigricoxa Dodd, assigned to insulare species group, type information).
Hadronotus avanus , comb. nov.
Gryon avanum Kozlov & Lê, 1992: 231, 237 (original description, assigned to muscaeforme species group, keyed).
Gryon avanus Kozlov & Lê, 1996: 12 (description); Lê, 2000: 99, 103 (description, keyed, type information).
Hadronotus baeiformis , comb. rev.
Prosacantha baeiformis Marshall, 1892: 75 (original description).
Hoplogryon (Hoplogryon) baeiformis (Marshall): Kieffer, 1910: 96 (generic transfer, subgeneric assignment).
Hadronotus baeiformis (Marshall): Kieffer, 1926: 455, 468 (generic transfer, description, keyed).
Gryon baeiforme (Marshall): Johnson, 1992: 379 (cataloged).
Comments
The original description states that the head is “partout fortement ponctuée” which translates to “strongly punctuated everywhere” and is the basis for transferring this species to Hadronotus.
Hadronotus barbiellinii , comb. rev.
Hadronotus Barbiellinii Costa Lima, 1940: 65 (original description).
Gryon barbiellinii (Costa Lima): De Santis, 1980: 312 (generic transfer); Johnson, 1992: 379 (cataloged, type information).
Comments
This species is returned to Hadronotus based on characters in the original description, “Face (frontal space located above the base of the antennae and inside the curved protruding line that separates it from the forehead) presenting, in the middle, deep longitudinal groove, transversely striated, at the sides of which there is an oblique series of 4 to 5 relatively wide areolas, immediately into the small areolas that border the edge of the eye and out of another series of areolas, much smaller, which are parallel to it.”
Hadronotus basokoi , comb. rev.
Hadronotus basokoi Risbec, 1958: 115 (original description).
Gryon basokoi (Risbec): Masner, 1976: 58 (generic transfer, systematic position); Johnson, 1992: 379 (cataloged, type information).
Comments
From the original description, “Quite deep postantennal depressions, clearly limited by two ridges which meet at a sharp angle. Crossed by fairly strong streaks.”
Hadronotus bicolor , comb. rev.
Hadronotus bicolor Ashmead, 1894: 229, 231 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 468 (description, keyed).
Gryon bicolor (Ashmead): Masner, 1976: 58 (generic transfer, taxonomic status); Mineo, 1980a: 190 (removed from synonymy with Gryon misellum Haliday); Johnson, 1992: 379 (cataloged).
Hadronotus bimaculatus , comb. nov.
Gryon bimaculatum Mineo, 1983c: 546, 551 (original description); Johnson, 1992: 380 (cataloged, type information).
Hadronotus bini , comb. nov.
Gryon bini Mineo, 1983c: 528, 546 (original description); Johnson, 1992: 380 (cataloged).
Hadronotus blaches , comb. nov.
Gryon blaches Kozlov & Lê, 1992: 225, 227 (original description, assigned to insulare species group, keyed).
Gryon blachis Kozlov & Lê, 1996: 10 (description); Lê, 2000: 98, 104 (description, keyed, type information).
Hadronotus bolivari , comb. rev.
Hadronotus Bolivari
Giard, 1895: 78 (original description. Type lost from
Hadronotus Proximus Kieffer, 1913: 244 (original description); Johnson, 1992: 380 (type information).
Hadronotus bolivari Giard: Kieffer, 1926: 454, 458 (description, keyed); Szabó, 1966: 430, 433 (description, keyed).
Hadronotus proximus
Kieffer: Kieffer, 1926: 454, 459 (description, keyed); Bin, 1974: 455 (type misssing from
Hadronotus ochraceus Szabó, 1966: 429, 431 (original description); Mineo, 1979a: 237 (junior synonym of Hadronotus Bolivari Giard); Johnson, 1992: 380 (type information).
Gryon proximus (Kieffer): Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 280 (description, keyed); Kononova & Petrov, 2002: 54 (keyed).
Gryon bolivari (Giard): Mineo, 1979: 237 (description, generic transfer); Mineo, 1981: 119, 120 (description, type information, keyed); Johnson, 1992: 380 (cataloged, type information); Mineo & Caleca, 1994: 117 (distribution, assigned to muscaeforme subgroup of muscaeforme group); Kononova & Kozlov, 2008: 325, 362 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
We return this species to Hadronotus based on a character in the original description, “head black, punctate.”
Hadronotus bosellii , comb. nov.
Gryon bosellii Mineo & Szabó, 1978b: 113 (original description); Mineo, 1981a: 119, 124 (diagnosis, keyed); Johnson, 1992: 380 (cataloged, type information); Mineo & Caleca, 1994: 117 (distribution, assigned to muscaeforme subgroup of muscaeforme group); Kononova & Petrov, 2002: 54 (keyed); Kononova & Kozlov, 2008: 325, 367 (description, keyed).
Hadronotus brasiliensis , comb. rev.
Hadronotus brasiliensis Costa Lima, 1928: 1 (original description).
Gryon brasiliensis (Costa Lima): De Santis, 1980: 312 (generic transfer).
Gryon brasiliense (Costa Lima): Johnson, 1992: 380 (cataloged, type information).
Comments
We transfer this species back to Hadronotus based on characters in the original description, “antennal suture or pit distinctly separated from the forehead by an arched cross-striated trench, leading the most saline striae of the midline to the areolas of the face.”
Hadronotus cabrucae , comb. nov.
Gryon cabrucae Mineo, Mineo & Caleca, 1994: 126 (original description, assigned to floridanum group).
Hadronotus canus , comb. nov.
Gryon canum Mineo, 1991: 15 (original description, assigned to leptocorisae species group); Mineo & Caleca, 1994: 122 (distribution).
Hadronotus carinatifrons , comb. rev.
Hadronotus carinatifrons Ashmead, 1894: 229, 230 (original description); Ashmead, 1900: 328 (distribution); Brues, 1910: 47 (keyed); Kieffer, 1926: 455, 467 (description, keyed).
Gryon carinatifrons (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Alayo Dalmau, 1973: 99 (cataloged); Masner, 1983: 134, 143 (type information, spelling error); Mineo & Caleca, 1987a: 32 (description, keyed); Johnson, 1992: 380 (cataloged, type information).
Gryon carinatiforns (Ashmead): Masner, 1976: 58 (type information, spelling error).
Hadronotus charon , comb. rev.
Hadronotus charon Nixon: Nixon, 1934b: 292, 306 (description); Risbec, 1950: 592, 595 (original description).
Gryon charon (Nixon): Masner, 1965: 75 (type information); Mineo, 1982b: 312 (description); Mineo, 1983a: 18 (description, variation, keyed); Johnson, 1992: 380 (cataloged, type information).
Hadronotus chelinideae , comb. nov.
Gryon chelinideae Masner, 1983: 133, 159 (original description, keyed); Johnson, 1992: 381 (cataloged, type information).
Hadronotus chinchillae , comb. nov.
Gryon chinchillae Caleca, 1990a: 119, 120 (original description, keyed).
Hadronotus circus , comb. nov.
Gryon circum Kozlov & Lê, 1992: 223, 227 (original description, assigned to insulare species group, keyed).
Gryon circus Kozlov & Lê, 1996: 10 (description); Lê, 2000: 97, 107 (description, keyed, type information).
Comments
The frons of this species suggests close relation to H. watshami.
Hadronotus clavigrallae , comb. nov.
Gryon clavigrallae Mineo, Mineo & Caleca, 1994: 116 (original description, assigned to fulviventre subgroup of muscaeforme group).
Hadronotus compoventris , comb. nov.
Gryon compoventre Kozlov & Lê, 1992: (original description, assigned to muscaeforme species group, keyed).
Gryon compoventris Kozlov & Lê, 1996: 11 (description); Lê, 2000: 99, 110 (description, keyed, type information).
Hadronotus coronatus , comb. nov.
Gryon coronatum Kononova, 2008: 322, 335 (original description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Comments
In the original description, figure 176 illustrates transverse striation across the frontal depression and a female antenna with five clavomeres.
Hadronotus cous , comb. rev.
Hadronotus cous Nixon, 1934b: 292, 301 (original description, keyed); Risbec, 1950: 592 (keyed).
Gryon cous (Nixon): Masner, 1965: 75 (type information).
Gryon coum (Nixon): Mineo, 1983c: 528, 546 (description, keyed); Johnson, 1992: 381 (cataloged, type information).
Comments
The original description provides characters that enable us to transfer this species to Hadronotus, including “Frons with a deep, well-defined impression which is completely margined.”
Hadronotus chromion , comb. nov.
Gryon chromion Kozlov & Lê, 1992: 232, 237 (original description, assigned to muscaeforme species group, keyed).
Gryon cromion Kozlov & Lê, 1996: 12 (description, misspelling); Lê, 2000: 100, 112 (description, keyed, type information).
Hadronotus cultratus , comb. nov.
Gryon cultratus Masner, 1979: 794, 799 (original description, keyed); Sarazin, 1986: 974 (type information).
Gryon cultratum Masner: Johnson, 1992: 381 (cataloged, type information).
Comments
This species is transferred to Hadronotus based on its placement in the variicorne group and characters presented in the original description: “head... with coarse transverse polygons”, “scutellum with polygons roughly rounded” and examination of a paratype specimen.
Hadronotus dasyni , comb. rev.
Hadronotus dasyni Nixon, 1934a: 2 (original description, keyed).
Gryon dasyni (Nixon): Masner, 1965: 75 (type information); Mineo, 1990: 90 (keyed); Johnson, 1992: 381 (cataloged, type information).
Comments
The original description and (Figure
Hadronotus david , comb. nov.
Gryon david Masner, 1979: 793, 798 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 381 (cataloged, type information).
Hadronotus dessarti , comb. nov.
Gryon dessarti Mineo, 1991: 38 (original description, assigned to oculatum species group).
Hadronotus diadematis , comb. nov.
Gryon diadematis Mineo, 1983a: 18, 19 (original description, keyed); Johnson, 1992: 381 (cataloged, type information).
Comments
We transfer this species to Hadronotus based on the description of the “completely enframed frontal depression... connected to the anterior ocellus by a ridge” provided in
Hadronotus dichromos , comb. nov.
Plastogryon bicolo
r Dodd, 1913b: 171 (original description. Preoccupied by Hadronotus bicolor
Plastogryon (Heterogryon) bicolor (Dodd): Kieffer, 1926: 447, 451 (description, subgeneric assignment, keyed).
Gryon bicolor (Dodd): Galloway, 1976: 91 (type information, generic transfer).
Gryon dichromos Galloway: Galloway & Austin, 1984: 79 (replacement name); Mineo, 1990a: 186 (description of male); Mineo, 1991: 7 (assigned to charon species group); Johnson, 1992: 381 (cataloged, type information).
Hadronotus discolor , comb. nov.
Gryon discolor Mineo & Szabó, 1978c: 94 (original description); Johnson, 1992: 382 (cataloged, type information).
Hadronotus drunores , comb. nov.
Gryon drunores Kozlov & Lê, 1992: 235 (original description, assigned to muscaeforme species group).
Gryon drumores Kozlov & Lê, 1992: 237 (keyed, misspelling).
Gryon drunoris Kozlov & Lê, 1996: 11 (description); Lê, 2000: 98, 113 (description, keyed, type information).
Hadronotus dubius , comb. nov.
Gryon dubium Kozlov & Kononova, 2004: 199 (original description); Kononova & Kozlov, 2008: 322, 333 (description, keyed); Timokhov, 2019a: 19 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia).
Hadronotus elegans , comb. nov.
Plastogryon elegans Dodd, 1914c: 94 (original description); Galloway, 1976: 111 (type information, status uncertain).
Plastogryon (Heterogryon) elegans Dodd: Kieffer, 1926: 447, 451 (description, subgeneric assignment, keyed).
Gryon elegans (Dodd): Mineo, 1990a: 185 (generic transfer, type information); Mineo, 1991: 7 (assigned to aureum species group); Johnson, 1992: 382 (cataloged, type information).
Comments
Hadronotus elongatus , comb. rev.
Hadronotus antestiae var. elongatus Risbec, 1950: 597 (original description); Mineo, 1990b: 50 (lectotype designation, synonymy); Johnson, 1992: 383 (type information).
Gryon antestiae var. elongatus (Risbec): Masner, 1976: 58 (generic transfer, type information).
Gryon risbeci Mineo, 1990b: 50 (original description, assigned to hiberus species group, a junior objective synonym of Hadronotus antestiae var. elongatus Risbec).
Hadronotus euclidis , comb. nov.
Gryon euclide Mineo, 1992: 21 (original description).
Hadronotus eugeniae , comb. nov.
Microphanurus eugeniae Risbec, 1953: 326 (original description).
Gryon eugeniae (Risbec): Masner, 1976: 58 (generic transfer, type information); Johnson, 1992: 382 (cataloged, type information).
Hadronotus eurystenis , comb. nov.
Gryon eurystene Mineo, 1992: 21 (original description)
Comments
Our transfer of this species to Hadronotus is based on the original description, which states that this species is “Closely related to G. canum” and examination of a paratype specimen
Hadronotus exsculptus , comb. rev.
Hadronotus exsculptus
Förster, 1861: 41 (original description); Dalla Torre, 1885: 76 (reprint of
Hadronotus Exsculptus Förster: Kieffer, 1913: 238 (description).
Gryon exsculptus (Förster): Kozlov, 1978: 620 (description); Mineo, 1979a: 244 (description); Kozlov & Kononova, 1989: 78 (keyed).
Gryon exsculptum (Förster): Mineo, 1981a: 119, 126 (description of male, diagnosis, keyed); Johnson, 1992: 382 (cataloged, type information); Kononova & Kozlov, 2008: 325, 364 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia).
Gryon exculptus (Förster): Kozlov & Kononova, 1990: 266, 272 (description, keyed, error); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 54 (keyed).
Gryon exculptum (Förster): Mineo & Caleca, 1994: 117 (spelling error, distribution, assigned to muscaeforme subgroup of muscaeforme group).
Hadronotus fervidus , comb. nov.
Gryon fervidum Mineo, 1992: 18 (original description).
Comments
The original description is brief, and characters needed to properly place this species are largely absent. We interpret “from upper margin of the frontal depression and because there is no ridge connecting the latter to anterior ocellus” to refer to a carinate margin of the frontal depression, as is seen in Hadronotus ancinla (
Hadronotus bicolor 88 holotype female (USNMENT01109345), head and mesosoma, lateral view 89 holotype female (USNMENT01109345), head, anterodorsal view 90 holotype female (USNMENT01109345), habitus, dorsal view 91 female (
Hadronotus flavios , comb. nov.
Plastogryon flavios Dodd, 1915: 32 (original description).
Gryon flavios (Dodd): Galloway, 1976: 91 (type information, generic transfer); Mineo, 1991: 7 (assigned to charon species group); Johnson, 1992: 382 (cataloged, type information).
Hadronotus flavipes , comb. rev.
Hadronotus flavipes
Ashmead, 1905: 399 (original description. Preoccupied by Gryon flavipes
Plastogryon fuscus
Dodd, 1915: 25, 26 (original description, keyed. Synonymized with Telenomus orestes Dodd by
Telenomus orestes Dodd, 1913a: 167, 168 (original description, keyed).
Liophanurus orestes (Dodd): Kieffer, 1926: 68, 90 (description, generic transfer, keyed).
Hadronotus leptocorisae Nixon, 1934: 2, 5 (original description, keyed. Preoccupied by Hadronotus leptocorisae Howard (1885). Synonymized with Hadronotus flavipes Ashmead by Mineo (1979)); Mineo, 1979: 247 (junior synonym of Hadronotus flavipes Ashmead); Mineo, 1990: 178 (incorrect placement); Johnson, 1992: 393 (type information).
Gryon nixoni Masner: Masner, 1965: 77 (replacement name for Hadronotus leptocorisae Nixon, type information, synonymized with Hadronotus flavipes Ashmead by Mineo (1979)); Mineo, 1979: 247 (junior synonym of Hadronotus flavipes Ashmead); Mineo, 1981: 119, 139 (description, keyed); Mineo, 1990: 178 (incorrect placement).
Gryon ferus
Masner & Muesebeck: Masner & Muesebeck, 1968: 35 (replacement name for Hadronotus flavipes Ashmead. Type information. Synonymized with Telenomus orestes Dodd by
Gryon fuscus (Dodd): Galloway, 1976: 91 (type information, generic transfer).
Gryon orestes (Dodd): Johnson, 1988b: 242 (type information, generic transfer); Mineo, 1990a: 178 (synonymy, variation); Johnson, 1992: 392 (cataloged, type information); Kononova & Kozlov, 2008: 324, 356 (description, keyed).
Hadronotus floridanus , comb. rev.
Hadronotus floridanus Ashmead, 1887: 118 (original description); Ashmead, 1893: 231, 232 (description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 463 (description, keyed).
Hadronotus robustus
Brues, 1907: 156 (original description. Synonymized by
Gryon robustus (Brues): Masner, 1965: 299 (type information, generic transfer).
Gryon floridanus (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 35 (lectotype designation).
Gryon floridanum (Ashmead): Masner, 1983: 135, 136 (description, synonymy, emendation, keyed); Mineo & Caleca, 1987: 32 (description); Johnson, 1992: 383 (cataloged, type information).
Hadronotus fulvicoxus , comb. nov.
Gryon fulvicoxa Komeda & Mita, in Komeda, Mita, Hirose & Yamagishi, 2020: 101, 128 (original description, keyed).
Comments
The transfer to Hadronotus is based on images and characters in the original description.
Hadronotus fulviventris , comb. rev.
Hadronotus fulviventris Crawford, 1912: 2 (original description).
Hadronotus antestiae
Dodd, 1920a: 351 (original description. Synonymized by
Gryon antestiae (Dodd): Masner, 1965: 74 (lectotype designation).
Gryon fulviventris (Crawford): Masner & Muesebeck, 1968: 35 (type information, generic transfer); Mineo, 1979a: 247 (synonymy); Mineo, 1981a: 119, 128 (diagnosis, keyed); Sharma, 1982: 336 (keyed); Lê, 2000: 98, 115 (description, keyed).
Gryon terraesanctae
Mineo & Szabó, 1978b: 116 (original description. Synonymized by
Gryon tico
Mineo & Szabó, 1978c: 96 (original description. Synonymized by
Gryon fulviventre (Crawford): Mineo, 1990a: 174 (emendation, variation); Johnson, 1992: 383 (cataloged, type information); Kononova & Kozlov, 2008: 322, 343 (description, keyed); Rajmohana, 2014: 34 (description, distribution).
Hadronotus gallardoi , comb. nov.
Notilena Gallardoi Brèthes, 1913: 85 (original description).
Gryon gallardoi (Brèthes): De Santis & Esquivel, 1966: 50 (generic transfer); Loiácono, 1980: 173 (description); Mineo & Caleca, 1987a: 37 (description); Johnson, 1992: 383 (cataloged, type information).
Comments
We transfer this species to Hadronotus based on characters in the original description, “Head punctate-umbilicate, face longitudinally impressed, crested on both sides, transverse striae and in the midst of the antennae longitudinally crested.”
Hadronotus geminus , comb. nov.
Gryon geminum Mineo, 1991: 6 (original description, assigned to acuteangulatum species group).
Comments
The original description of G. geminum is so sparse that it can hardly be considered a description. It merely states that this species differs from G. austini by the sculpture of the frons, but with no mention of how it is different. This approach to species descriptions is of no benefit and has created significant obstacles for advancing taxonomy in this group.
Hadronotus giganteus , comb. nov.
Gryon giganteum Mineo, 1983c: 529, 546 (original description, keyed); Johnson, 1992: 384 (cataloged, type information).
Hadronotus gnidus , comb. rev.
Hadronotus gnidus
Nixon, 1934b: 292, 305 (original description, keyed. Synonymized by
Gryon gnidum (Nixon): Mineo & Caleca, 1994: 117 (treated as valid species, distribution, assigned to fulviventre subgroup of muscaeforme group).
Comments
The original description compares this species to H. antestiae (junior synonym of H. fulviventris), and we confirm that H. fulviventris belongs in Hadronotus based on examination of the holotype. We also examined two paratypes of H. gnidus, one male and one female.
Hadronotus goliath , comb. nov.
Gryon goliath Masner, 1979: 793, 798 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information).
Hadronotus grenadensis , comb. rev.
Hadronotus grenadensis Ashmead, 1896: 800 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 466 (description, keyed).
Gryon grenadensis (Ashmead): Masner, 1965: 76 (type information, generic transfer); Masner, 1976: 58 (description, systematic position).
Gryon grenadense (Ashmead): Johnson, 1992: 384 (cataloged, type information).
Comments
We transfer this species based on characters in the original description, “Facial impression transversely striated, margined.”
Hadronotus hectoris , comb. nov.
Gryon hectore Mineo, 1992: 25 (original description).
Comments
We transfer this species to Hadronotus based on characters presented in the original description, “frontal depression that is moderately large and deep, finely enframed and densely striated.”
Hadronotus helavai , comb. nov.
Gryon helavai Masner, 1979: 793, 797 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information).
Hadronotus hercules , comb. nov.
Gryon hercules Masner, 1979: 793, 801 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information).
Hadronotus hiberus , comb. rev.
Hadronotus hiberus Nixon, 1934b: 292, 299 (original description, keyed); Risbec, 1950: 592 (keyed).
Gryon hiberus (Nixon): Masner, 1965: 76 (type information, generic transfer); Mineo, 1990b: 49 (description, assigned to hiberus species group); Johnson, 1992: 384 (cataloged, type information).
Comments
We transfer this species to Hadronotus based on characters from the original description, “Frons with a fairly deep, more or less oval impression which is sharply and completely margined.”
Hadronotus hidakae , comb. nov.
Gryon hidakae Mineo, 1980b: 218, 220 (original description, keyed); Johnson, 1992: 384 (cataloged, type information); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 331, 420 (description, keyed).
Comments
We transfer this species based on the sculpturing of the frontal depression, illustrated in Figure II-1 in the original description.
Hadronotus hilaris , comb. nov.
Gryon hilare Mineo, Mineo & Caleca, 1994: 115 (original description, assigned to aureum group).
Hadronotus hirsutioculus , comb. rev.
Hadronotus hirsutioculus Girault, 1925: 183 (original description).
Gryon hirsutioculus (Girault): Galloway, 1976: 91 (type information, generic transfer).
Gryon hirsutioculum (Girault): Mineo, 1990a: 186 (emendation, type information, systematic position); Johnson, 1992: 384 (cataloged, type information); Mineo & Caleca, 1994: 114 (assigned to hirsutioculum group).
Gryon hyrsutioculum (Girault): Mineo, 1991: 39 (description, misspelling).
Comments
We transfer this species back to Hadronotus based on characters in the original description, “face bounded by an arched carina above” and “vertex is also more rudely punctured.”
Hadronotus histricus , comb. nov.
Gryon histricum Mineo, 1991: 7 (original description, assigned to aureum species group).
Hadronotus hogenakalensis , comb. nov.
Gryon hogenakalensis Sharma, 1982: 329, 336 (original description, keyed); Lê, 1997: 23 (keyed); Lê, 2000: 99, 118 (description, keyed, type information).
Gryon hogenakalense Sharma: Johnson, 1992: 384 (cataloged).
Hadronotus hystericus , comb. nov.
Gryon hystericum Mineo, 1991: 16 (original description, assigned to leptocorisae species group).
Hadronotus ialokombae , comb. nov.
Gryon ialokombae Mineo, 1983c: 547, 551 (original description, keyed); Mineo, 1990a: 181 (description); Johnson, 1992: 385 (cataloged, type information).
Hadronotus iammancoi , comb. nov.
Gryon iammancoi Mineo, 1983s: 530, 546 (original description, keyed); Johnson, 1992: 385 (cataloged); Kononova & Kozlov, 2008: 329, 403 (description, keyed).
Hadronotus iasonis , comb. nov.
Gryon iasone Mineo, 1992: 21 (original description).
Comments
The original description is brief and does little to place this species. However,
Hadronotus indicus , comb. nov.
Hadrophanurus indicus Subba Rao & Chacko, 1962: 478–479 (original description, keyed)
Gryon indicum (Subba Rao & Chacko): Johnson, 1992: 385 (cataloged, type information).
Comments
We transfer this species based on characters from the original description, “frons with a shallow depression having transverse striations and a small keel between the base of the antennae.”
Hadronotus ingens , comb. nov.
Gryon ingens Veenakumari & Rajmohana, 2016: 44 (original description).
Comments
The transfer to Hadronotus is based on characters and figures in the original description.
Hadronotus insularis , comb. rev.
Hadronotus insularis Ashmead, 1894: 229, 230 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 465 (description, keyed).
Gryon insularis (Ashmead): Masner, 1975: 212 (keyed); Masner, 1976: 58 (type information, description); Mineo, 1979a: 251 (description); Mineo, 1980a: 197 (junior synonym of Gryon leptocorisae (Howard)).
Gryon insulare (Ashmead): Masner, 1983: 134, 161 (description, emendation, keyed); Johnson, 1992: 385 (cataloged, type information).
Lectotype designation
We here designated specimen USNMENT01338539 as the lectotype of this species.
Hadronotus introversus , comb. nov.
Gryon introversum Mineo, 1991: 14 (original description, assigned to introversum species group).
Comments
We transfer this species based on characters in the original description, “mandibles with 3 subequal teeth” and “epomia... complete”, and images of the head provided in Figure IV.
Hadronotus janus , comb. rev.
Hadronotus janus Nixon, 1934b: 292, 304 (original description, keyed); Risbec, 1950: 592 (keyed).
Gryon janus (Nixon): Masner, 1965: 76 (type information, generic transfer); Masner, 1976: 58 (taxonomic status); Mineo, 1983c: 532, 546 (description, keyed); Johnson, 1992: 385 (cataloged, type information); Kononova & Kozlov, 2008: 331, 422 (description, keyed).
Comments
We transfer this species back to Hadronotus based on the original description, “A species closely related to H. cous” and “Mesonotum...quite strongly rugose.”
Hadronotus japonicus , comb. rev.
Hadronotus japonicus Ashmead, 1904c: 74 (original description); Kieffer, 1926: 453, 460 (description, keyed).
Gryon japonicus (Ashmead): Masner & Muesebeck, 1968: 35 (type information, generic transfer); Mineo, 1979a: 252 (description).
Gryon japonicum (Ashmead): Mineo, 1981a: 119, 130 (description of male, emendation, keyed); Johnson, 1992: 385 (cataloged, type information); Lê, 2000: 99, 119 (description, keyed); Kononova & Kozlov, 2008: 331, 421 (description, keyed).
Gryon mischa Kozlov & Kononova, 1989: 80, 94 (original description, keyed); Kozlov & Kononova, 1990: 268, 294 (description, keyed); Johnson, 1992: 388 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 330, 413 (description, keyed); Komeda, Mita, Hirose & Yamagishi, 2020: 106 (junior synonym of Gryon japonicum (Ashmead)).
Hadronotus javensis , comb. rev.
Hadronotus javensis Dodd, 1914e: 162 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 454, 460 (description, keyed).
Gryon javense (Dodd): Johnson, 1992: 385 (cataloged, type information).
Comments
We return this species to Hadronotus based on the original description, “Head and thorax reticulately rugulose.”
Hadronotus karnalensis , comb. nov.
Hadrophanurus karnalensis Chacko & Katiyar, 1961: 161 (original description); Subba Rao & Chacko, 1962: 479 (keyed).
Gryon karnalense Chacko & Katiyar: Johnson, 1992: 385 (cataloged).
Comments
We transfer this species based on the original description, “frons with a median longitudinal shallow depression with transverse striations and with a keel at the base of the antennae.”
Hadronotus kelnerpillauti , comb. nov.
Gryon kelnerpillauti Mineo, 1983b: 286, 287 (original description, keyed); Johnson, 1992: 386 (cataloged, type information).
Hadronotus kenyotus , comb. nov.
Gryon kenyotum Mineo, 1982b: 304 (original description); Mineo, 1990c: 90 (keyed); Johnson, 1992: 386 (cataloged, type information); Mineo, 1992: 17 (assignment to letus species group).
Comments
This species belongs in Hadronotus based on examination of a paratype specimen as well as characters from the original description, “The series of basiconic-type sensilla, lying on the middle of the ventral surface of the antennomeres A12-A7 is 2,2,2,2,2,0. Frontal depression enframed all round, its upper side connected to the median ocellus by a ledge.”
Hadronotus kozlovi , comb. nov.
Gryon oculatum Kozlov & Kononova, 2004: 205 (original description); Kononova & Kozlov, 2008: 325, 360 (description, keyed).
Gryon kozlovi Özdikmen, 2011: 772 (replacement name for Gryon oculatum Kozlov & Kononova); Timokhov, 2019a: 19 (distribution).
Comments
Figure
Hadronotus krishnagiriensis , comb. nov.
Gryon krishnagiriensis Sharma, 1982: 333, 336 (original description, keyed).
Gryon krishnagiriense Sharma: Johnson, 1992: 386 (cataloged).
Hadronotus laticeps , comb. rev.
Hadronotus laticeps Kieffer, 1908: 144 (original description); Kieffer, 1926: 453, 457 (description, keyed).
Hadronotus Laticeps Kieffer: Kieffer, 1913: 240 (description).
Gryon laticeps (Kieffer): Johnson, 1992: 386 (cataloged, type information).
Comments
We transfer this species based on the original description, “superficial frontal impression, going beyond the middle of the eyes, dull, not marginal, ridged across.”
Hadronotus latipennis , comb. nov.
Platyteleia latipennis Dodd, 1913a: 154 (original description); Dodd, 1914b: 80 (description of female); Kieffer, 1926: 409 (description, keyed); Galloway, 1976: 101 (type information).
Gryon latipennis (Dodd): Galloway & Austin, 1984: 79 (generic transfer).
Gryon latipenne (Dodd): Johnson, 1992: 386 (cataloged, type information).
Hadronotus latus , comb.n.
Austroscelio latus Dodd, 1916: 28 (original description); Galloway, 1976: 85 (type information).
Gryon latus (Dodd): Galloway & Austin, 1984: 80 (generic transfer).
Gryon latum (Dodd): Mineo, 1990b: 52 (assigned to insulare species group, type information); Johnson, 1992: 386 (cataloged, type information).