Research Article
Print
Research Article
Hygienic behavior and antimicrobial peptide expression of the leaf-cutting ant Atta cephalotes (Hymenoptera, Formicidae) to Metharhizium anisopliae
expand article infoJuan Sebastián Gómez-Díaz, Andrea Niño-Castro, Sandra Milena Valencia-Giraldo, Karent Mariana Cotazo-Calambas
‡ Universidad del Valle, Cali, Colombia
Open Access

Abstract

Leaf-cutting ants depend on mutualisticfungi to survive. An infection that massively affects the workers compromising the proper maintenance of the fungus, or that can attack the fungus garden, can be fatal to the colony. Thus, leaf-cutting ants have evolved a complex defense system composed of both innate individual immunity and collective immunity to protect the colony against potential threats. To characterize the collective and individual immunity of Atta cephalotes workers to Metarizhium anisopliae we assessed the hygienic behavior and the expression of antimicrobial peptides of A. cephalotes workers triggered by Metarizhium anisopliae spores. As a control challenge, workers were treated with water. Regardless of whether the challenge was with water or spore suspension, A. cephalotes workers displayed an immediate response characterized by an increase in time spent both self-grooming and collective grooming along with a reduction in time spent fungus-grooming. The individual immunity triggered the expression of abaecin as early as 24 hours post-infection, exclusively in workers challenged with M. anisopliae. In contrast, the level of expression of defensin remained constant. These results suggest that upon being challenged with a suspension of M. anisopliae spores, A. cephalotes workers deploy both collective and individual immunity to produce a response against the invader. However, when the spores of M. anisopliae are applied as liquid suspension collective immunity deploys a generic strategy, while individual immunity shows a specific response against this entomopathogen.

Keywords

abaecin, allogroming, defensin, expression, fungus grooming, gene, self-grooming

Introduction

Attine ants (Formicidae: Myrmicinae: Attini: Attina) comprise approximately 250 species that establish associations with mutualisticfungi as a source of nutrition (Ward et al. 2015; Branstetter et al. 2017). Leaf-cutting ants of genera Atta and Acromyrmex are among the most derived of the tribes, in which they cultivate Leucoagaricusfungi using fresh plant material as a substrate (Chapela et al. 1994; Mueller et al. 2001, 2005). In return, mutualistfungi produce gongylidia—specialized structures used to feed the queen and the brood (Hölldobler and Wilson 2010). To assure fungus garden productivity, the workers select, harvest, and process large quantities of suitable plant material (Littledyke and Cherrett 1978; Folgarait et al. 1996; Estrada et al. 2013; Rocha et al. 2017) and build complex nests underground to provide an optimum environment for fungus growth (Kleineidam and Roces 2000; Bollazzi and Roces 2010; Verza et al. 2017). For instance, the nest can have up to thousands of chambers inhabited by millions of individuals in species of Atta (Jonkman 1980; Moreira et al. 2004).

The social lifestyle of leaf-cutting ants could, in principle, make them prone to infections with hazardous microorganisms for workers or the fungus garden (Hughes et al. 2002) due to enhanced transmission between frequently interacting individuals with a similar genetic background that possibly are susceptible to the same pathogens (Wilson et al. 2003; Pie et al. 2004; Cremer et al. 2007). In this sense, workers are in permanent contact withfungi that can overgrow the mutualist (e.g., Syncephalastrum racemosum and Trichoderma harzianum) that inhabit the soil and within the plant tissue they cut (Rodrigues et al. 2009; Rocha et al. 2017). Furthermore, infection of the fungus garden by Escovopsis, a specialized parasite of the mutualist (Muchovej and Della Lucia 1990; Seifert et al. 1995; Currie et al. 1999; Currie and Stuart 2001), is frequently detected in the garden of leaf-cutting ants, but it only significantly compromises the garden if the ants cannot groom the mutualist or properly dispose of the waste (Heine et al. 2018).

To protect the colonies against infection, leaf-cutting ants have evolved a complex defense system composed of the innate immunity of individuals and collective immunity. Individual immunity involves physiologic mechanisms to clear potential threats, including the production of reactive oxygen species, encapsulation, and the production of antimicrobial peptides (Hoffmann 1995). In contrast, collective immunity is based on altruistic behaviors that result in avoidance, control, or elimination of parasitic infections (Siva-Jothy et al. 2005; Masri and Cremer 2014). Once a potential hazard is detected, the workers deploy hygienic behaviors of collective immunity including self-grooming, allogrooming (Fernández-Marín et al. 2003; Reber et al. 2011), and fungus grooming (Currie and Stuart 2001; Little et al. 2006; Cremer et al. 2007). The particles removed via hygienic behaviors are compacted, possibly sterilized in the infrabucal pocket, and dumped as pellets (Little et al. 2003, 2006). This hygienic behavior is complemented by chemical defenses mediated by secretions of exocrine glands and the metapleural gland that contain fungal and bacterial inhibitors (Do Nascimento et al. 1996; Poulsen et al. 2003; Rodrigues et al. 2008; Fernández-Marín et al. 2015).

In addition to these mechanisms, Acromyrmex workers maintain a symbiosis with Pseudonocardia—an antibiotic-producing actinobacterium maintained in the cuticle. This association protects the fungus garden against infection with parasitic fungus Escovopsis (Currie et al. 2003; Poulsen et al. 2010; Cafaro et al. 2011). In contrast, Atta species have lost or reduced the symbiosis with Pseudonocardia (Currie et al. 2006; Mueller et al. 2008) suggesting that they rely more on collective immunity and chemical disinfection to protect the colony against invaders (Fernández-Marín et al. 2009).

The first barrier of individual immunity in leaf-cutting ants is a hard exoskeleton reinforced with a biomineral armor that protects workers from invaders in most cases (Siva-Jothy et al. 2005; Li et al. 2020). However, specific pathogens such as entomopathogenic fungus Metarizhium anisopliae can penetrate the worker’s cuticle and reach the hemocoel (Hajek and St. Leger 1994; Moino Jr et al. 2002). In insects, constitutive mechanisms of innate immunity such as profenol oxidase cascade, phagocytosis, and reactive oxygen species production act to neutralize the microorganism as the first line of defense (Nappi and Christensen 2005; Evans et al. 2006; Buchon et al. 2014). The expression of antimicrobial peptides (AMPs) is induced after this generic response. These molecules eliminate the microorganisms via pore formation or metabolism disruption (Bulet et al. 2004; Siva-Jothy et al. 2005; Haine et al. 2008). The genome of leaf-cutting ants, Atta cephalotes and Acromyrmex equinatior contains sequences that code to abaecins, hymenoptaecins, and defensins (Zhang and Zhu 2012). Furthermore, abaecin and hymenoptaecin are expressed as a part of the immune response of Ac. equinatior workers against M. anisopliae (Yek et al. 2013).

The collective immunity of Acromyrmex against M. anisopliae has been previously described (Richard and Errard 2009; Walker and Hughes 2009; Morelos-Juárez et al. 2010; Abramowski et al. 2011; Yek et al. 2013; Tranter et al. 2015; Nilsson-Møller et al. 2018; Calheiros et al. 2019). In contrast, the collective immunity of Atta has been less explored (Fernández-Marín et al. 2006; Fernández-Marín et al. 2009; Walker and Hughes 2011) and the research has been primarily centered on describing metapleural gland grooming. While this evidence highlights the relevance of chemical disinfection in Atta species, it does not assess the full spectrum of workers’ behavior upon a challenge with an entomopathogen. Furthermore, studies that simultaneously assess innate and collective immunity responses against an entomopathogen in leaf-cutting ants are scarce (Yek et al. 2013). To characterize the collective and individual immunity of A. cephalotes workers to M. anisopliae, we assessed workers’ hygienic behavior before and after a challenge with M. anisopliae. We evaluated the time spent by workers executing self-grooming, allogrooming, metapleural gland grooming, fecal fluid grooming, and the production of infrabuccal pellets. In addition, we evaluated the expression of antimicrobial peptides abaecin and defensin as effectors of individual immunity. We hypothesized that upon a challenge with M. anisopliae, workers deploy collective and individual immunity to clear the entomopathogen.

Methods

Leaf-cutting ant nest collection and immune challenge preparation

Between January and December of 2019, twelve mature nests of A. cephalotes were selected and collected in Santiago de Cali, Valle del Cauca, Colombia (3°22'33.24"N, 76°32'0.24"W). At least 400 g of fungus accompanied by workers was extracted per nest. The collected material was kept undisturbed for at least one week in 10 L plastic containers connected to a waste chamber (Valderrama et al. 2006). Microcolony arrangements were established to carry out the assays based on these source colonies. The composition of the microcolonies, as well as their number, will be described for each experiment.

Metarhizium anisopliae was isolated from commercial product BIO-MA (Bioproteccion SAS, Colombia). Initially, 90 g of product was resuspended in 90 ml of sterile water. Serial dilutions of this suspension were then cultured in potato dextrose agar (PDA) (BD, USA) to obtain axenic cultures. From these cultures, liquid suspensions of conidia at a concentration of 107 conidia/ml were prepared as a treatment.

Experiment 1: Behavioral response to M. anisopliae exposure

Five mature nests of A. cephalotes were selected to assess the behavioral response to M. anisopliae. Six microcolonies composed of 15 medium workers (cephalic width 1.4–1.8 mm) and 0.5 g of mutualistic fungus were established from each nest. The microcolonies were randomly assigned to treatment with spores of M. anisopliae or treatment with water. Each microcolony was placed in a glass box (10 × 15 × 9 cm) with walls coated with Fluon plus (Bioquip, USA). The workers were left undisturbed for 90 minutes to adapt to the new environment. Then video recordings of the one-hour basal period were taken. Next, the microcolonies assigned to spore treatment were sprayed with approximately 400 µl of the spore suspension evenly distributed between fungus and workers. Simultaneously, Control microcolonies were sprayed with 400 µl of water. Immediately after the treatment was applied, the activity of each microcolony was video recorded for 2 hours. The recordings were acquired with a GoPro Hero 5 Black edition (GoPro, USA) camera coupled with a macro lens (PolarPro, USA) at 60 photograms per second and 1080 megapixels. At the end of the video recording, the 15 ants of each microcolony were transferred to Petri dishes and given an agar diet (Bueno et al. 1997). The infrabuccal pellets produced by the workers were counted after 24 hours (Fig. 1A).

Figure 1. 

Description of A. Experimental design and B. Video recording analysis used to assess the behavioral response of Atta cephalotes workers to M. anisopliae

The video recordings obtained from each microcolony for the basal period and the two hours after treatment were divided into 10-minute segments. For each of these segments, three minutes of footage were randomly selected to record the behavior of ten workers. The workers were digitally labeled to score the time spent for each one of them in the execution of five hygienic behaviors associated with collective immunity: self-grooming, allogrooming, fecal fluid grooming, fungus grooming, and metapleural gland grooming, defined according to the literature as follows:

Self-grooming

The antennae are pulled through the antenna cleaners on the front legs, then the ant cleans the legs and the antenna cleaners, by pulling the legs through the mouthparts, removing particles with the glossa (Nilsson-Møller et al. 2018).

Allogrooming

One or more grooming ants approached a recipient worker. The antennae of the grooming ants are pointed towards a specific point of the receiving ant or are moving and lightly tapping the receiver. The maxillae and lower labium mouthparts are open, with the glossa emerging to lick the receiver ant (Nilsson-Møller et al. 2018).

Fungus grooming

The ant stops leg movements at a fixed point on the fungus garden. The antennae are motionless and parallel pointed towards the mutualistic fungus, and the tip of the antennae are almost touching each other, close to the tips of the mandibles. The maxillae and lower labium mouthparts are open, with the glossa emerging to lick the fungus (Currie and Stuart 2001; Nilsson-Møller et al. 2018).

Metapleural gland grooming

The ant leans to one side to reach one of its front legs to rub the meatus of the metapleural gland. The other front leg is simultaneously licked by the glossa. The ant leans to the opposite side and switches legs and repeats the same motion with the opposite legs. (Fernández-Marín et al. 2006; Nilsson-Møller et al. 2018).

Fecal fluid grooming

The ant bends its gaster and head towards each other to apply a droplet of fecal fluid to the mouthparts. the ant pulls the front legs through the mandibles, one at a time. Subsequently, the ant moves the antennae through the antenna cleaners located on the tibia-tarsus joint of the front legs (Nilsson-Møller et al. 2018).

This procedure was repeated until the observation was completed for ten labeled workers in each segment of three minutes. Finally, the video recordings were analyzed independently by two observers blinded to the treatments. (Fig. 1B).

Experiment 2: Worker’s survival and colonization by M. anisopliae

The pathogenicity of the M. anisopliae strain was confirmed by assessing the percentage of colonization. Here, four colonies were chosen to extract 60 individuals that were randomly assigned to a challenge either with water or a spore suspension. After the challenge, workers were transferred to sterile Petri dishes with diet agar in groups of 10 ants. The number of living workers was recorded every 24 hours for ten days. The dead ants were then removed and disinfected in sodium hypochlorite (0.7%) solution followed by three washes with sterile water. Finally, the corpses were transferred to Petri dishes lined with absorbent paper moistened with sterile water. After five days of incubation, the corpses were assessed under a stereomicroscope SMZ-745 (Nikon, Japan) to determine colonization by detecting mycelial growth from inside the intersegmental sections (Moino Jr et al. 2002).

Experiment 3: Gene expression associated with innate immunity in workers

To evaluate gene expression, 12 microcolonies from three nests were selected. The microcolonies were composed of 100 medium workers and 5 g of mutualistic fungus. Six microcolonies were randomly assigned to the challenge with spore suspension, and six microcolonies were assigned to a sterile water control. Each microcolony was placed on a glass box, and the corresponding treatment was applied. Twenty ants per microcolony were collected before and at 24, 48, and 72 hours after applying the challenge. An additional sample of 20 workers challenged with M. anisopliae was collected to assess the efficiency of the primers at 24 h. The collected ants were kept in liquid nitrogen until RNA isolation.

RNA extraction and relative gene expression

The RNA extractions were performed using the SV Total RNA Isolation System (Promega, USA) following the manufacturer’s instructions. The RNA quantity and integrity were assessed by agarose gel (2%) electrophoresis and analysis with a NanodropTM spectrophotometer (ThermoFisher, USA). The RNA extracted from the ants was reverse transcribed with cDNA synthesis kit ProtoScript First Strand cDNA Synthesis (New England Biolabs, USA).

The RNA extractions were carried out using the SV Total RNA Isolation System (Promega, USA) following the manufacturer’s instructions. The RNA quantity and integrity were assessed with agarose gel (2%) electrophoresis and NanodropTM spectrophotometer analysis (ThermoFisher, USA). The RNA extracted from the ants was reverse transcribed with a cDNA synthesis kit (ProtoScript First Strand cDNA Synthesis; New England Biolabs, USA).

Previously reported primers were used for abaecin and ribosomal protein L18 (rpL18) (Chérasse et al. 2018). For the defensin and NADH dehydrogenase (NADH), primers were designed by Primer-BLAST (NCBI) using A. cephalotes-specific sequences available in the Gen Bank (NCBI) for defensin (BK008405.1) and NADH (XM_012205180.1). The primers were designed to span an exon-exon junction, thus avoiding the amplification of the contaminating genomic DNA (Table 1).

Table 1.

List of the specific primers used for expression assays.

Gene Primer name Sequence (5’-3’) Amplicon size (bp) Efficiency (%) Reference
abaecin Aba-f ATCTTCACTCTGCTCTTGGC 156 103 Chérasse et al. 2018
AbaM-r AATGAGGAAATCTGATCTTCGG
defensin DG2-f TGAAGCTGTTCGCTATCCTCG 112 90 This study
DG2-r GGATCCTCGATGGTAGTCAGTTC
ribosomal protein (rpL18) CRL18-f TCCCCAAGTTGACGGTATG 140 97 Chérasse et al. 2018
CRL18M-r TCCCTGCATCAAGACTGTAC
NADH NAC1-f AGAGCAGATGGATCTCGACG 122 100 This study
NAC1-r AATTCGAAGTTGGGACCCTCA

Quantitative PCR was carried out in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA) with a reaction mix containing 4 µl of cDNA, 5 µl de 2 × SsoFast EvaGreen (Bio-Rad, USA), and 0.5 µl of each primer (10 µM). The amplification conditions were 95 °C for 3 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 30 s; melt curves were run after 40 amplification cycles while increasing the temperature from 60 to 95 °C; each sample was assessed in duplicate. A no templated control was included as a negative control for each primer.

The primer’s efficiencies were determined using standard curves as previously described (Pfaffl 2001; Moreira et al. 2017). The efficiencies (E) and the mean Ct (threshold cycle) were used to calculate relative expression (RE) of gene targets abaecin and defensin compared to housekeeping genes rpL18 and NADH equation 1 (Chérasse et al. 2018):

 (1)

The fold change in expression of each target at different time points was estimated by dividing the relative expression values at 24, 48, and 72 h by the relative expression at 0 h.

Statistical analyses

All the statistical analyses were performed using R version 4.0.2 (Core-Team 2020)

The consistency of the observations recorded by the observers was contrasted while calculating a two-way mixed-effects intraclass coefficient (ICC) using the psych package (Revelle 2022). The time spent by all the workers in a microcolony in each hygienic behavior was summed for the basal period, the first hour, and the second hour post-challenge. The resulting data were log10 transformed to satisfy the assumptions of normality and homoscedasticity. Independent mixed linear models were calculated for each behavior using the nlme package (Pinheiro and Bates 2022). For the time spent in self-grooming, allogrooming, fecal fluid grooming, and fungus grooming, the fixed factors were: (i) treatment (spraying with water or infection with M. anisopliae spores), (ii) time (baseline period, the first and second hours after the application of the challenge), and (iii) the interaction between time and treatment. For the variable production of infrabucal granules, treatment was set as the only fixed factor was the treatment. The nest was set as a random factor for all models.

The impact of treatment on worker survival was assessed via Cox regression using the Survival package (Therneau and Grambsch 2000; Therneau 2022). The treatment (M. anisopliae challenge or control challenge), nest, and interaction between treatment and nest were considered fixed effects.

The fold change in the expression of antimicrobial peptides, abaecin, and defensin was logarithmic transformed (log10), and independent linear mixed models were calculated. The treatment (M. anisopliae challenge or control challenge), time (24, 48, and 72 h), and interaction between treatment and time were considered fixed factors. The nest was considered as a random effect.

The Anova function of the CAR package (Fox and Weisberg 2018) was used in all models calculated to evaluate whether the fixed factors affected the response variables. Tukey’s multiple comparisons were performed using the multcomp package when fixed factors significantly affected the response variable (Hothorn et al. 2016).

Results

The ICC was 0.76, thus suggesting that the behavioral observations were consistent between observers. Self-grooming was a behavior in which workers invested more time before and after the application of challenges. In the basal status, workers spent a median of 1000 seconds dedicated to self-grooming; the investment in fungus grooming was seen for a median of 160 s; the time invested in allogrooming and fecal fluid grooming was under 100 s (Fig. 2 A–D). The metapleural gland grooming was detected only once in the 5440 s of footage; hence, the time invested in this behavior is negligible.

Figure 2. 

Time invested by Atta cephalotes workers in prophylactic behavior during the basal period (0 h) the first hour, and the second hour after challenge with water (white boxes) or Metarizhium anisopliae spores (gray boxes) A self-grooming B allogrooming C fungus grooming, and D fecal fluid grooming. Each box represents the sum of the time in seconds invested in each behavior from 10 workers (n = 5 nests, 60 workers per nest). Different letters indicate significant differences (p < 0.05).

Workers reacted to the treatments by increasing their investment in self-grooming: However, the time after challenge (F = 49.54, p < 0.0001, Df 9)—but not the nature of the treatment itself (F = 0.66, p = 0.4, Df 9)—influenced their behavior. In the first hour after the challenge, workers duplicated the time investment in self-grooming behavior (Tukey test p < 0.0001). The time investment in self grooming decreased in the second hour, but it was higher than in the basal status (Tukey test p < 0.0001) (Fig. 2A).

A similar tendency was observed for the time invested in allogrooming. Workers increased the time investment in this behavior depending on the time after the treatment (F = 6.32, p = 0.0028, Df 9) no matter whether they were challenged with water or M. anisopliae conidia (F = 0.16; p = 0.68, Df 9) (Fig. 2B). Workers almost duplicated the time invested in allogrooming in the first hour after challenges. This variable returned to basal levels in the second hour (Tukey test p = 0.83).

Workers showed a significant reduction in the time invested in fungus grooming after challenge (F = 6.4, p < 0.0026, Df 9) independent of whether they were challenged with water or spores (F = 0.78, p < 0 .37, Df 9) (Fig. 2C). In the first hour after the challenge, workers reduced the time investment in fungus grooming by approximately 60% (Tukey test p = 0.0228). This reduction was maintained in the second hour after treatment (Tukey test p = 0.010). In contrast, workers did not modify the time invested in fecal fluid grooming after the challenge neither in response to the time after treatment (F = 2.02, p = 0.16, Df 9) nor to nature of the treatment (F = 0.54, p = 0.58, Df 9) (Fig. 2D). Finally, workers treated with M. anisopliae showed ten-fold more infrabuccal pellets than control workers treated with water 24 h after the challenge (F = 124.80, p < 0.0001) (Fig. 3).

Figure 3. 

Production of infrabuccal pellets 24 hours after control challenge with water or spores of Metarhizium anisopliae. (n = 5 nests, 60 workers assessed per nest). Significant differences are marked with asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001).

The workers’ survival decreased progressively in control-treated workers and workers treated with spores over the ten-day observation period. However, the workers treated with M. anisopliae spores showed higher mortality from day four than workers treated with water (z = 2.80, p = 0 .005) (Fig. 4). Furthermore, the colonization assay showed that 80% of worker’s corpses were effectively colonized by M. anisopliae; no signs of colonization were observed in water-treated workers (data not shown).

Figure 4. 

The survival probability of Atta cephalotes workers upon control challenge with water (blue line) or spores of Metarhizium anisopliae (black line). Blue and black dashed lines represent the 95% confidence interval. n = 4 nests with 60 workers assessed per nest.

The expression of abaecin was affected by treatment (F = 6.2, p = 0.03). Workers treated with M. anisopliae showed an increase in the expression of abaecin as early as 24 h after the challenge. The expression of abaecin increased by nearly 200-fold at 48 h versus immediately after the challenge (Fig. 5A). In contrast, the expression of abaecin remained similar across time points in workers treated with water. The expression of defensin increased at 48 h after the challenge in workers treated with a spore suspension; however, no significant differences were detected versus expression before treatment (Fig. 5B).

Figure 5. 

Expression of antimicrobial peptides in workers of Atta cephalotes upon challenge with water (white boxes) or spores of Metharhizium anisopliae (gray boxes) A abaecin B defensin. n = 3 nests; 20 workers assessed per time point. Significative differences are marked with asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001).

Discussion

The results indicated that under laboratory conditions, A. cephalotes workers reacted to a potential hazard by increasing their time investment in self-grooming and allogrooming and reducing their interaction with the fungus. These hygienic behaviors were complemented by the production of infrabuccal pellets. However, the results suggest that workers could not discriminate an innocuous challenge from an actual hazard. Hence, the time invested in hygienic behaviors was similar between workers treated with water and workers treated with spores of M. anisopliae. Furthermore, workers were unable to clear the spores completely under this experimental setup—the invader reached the hemocoel triggering a rise in the expression of abaecin. Finally, infection with M. anisopliae decreased the workers’ survival.

Workers of A. cephalotes combined self-grooming and allogrooming to remove the contaminants applied directly to their bodies, thus suggesting that this is the first line of defense against a potential hazard. Self-grooming has been identified as a proactive behavior widely extended in social insects including ants, wasps (Sumana and Starks 2004), bees (Morfin et al. 2020), and termites (Yanagawa et al. 2008). In leafcutter ants, this behavior is deployed by several species in response to challenges applied directly to the workers and to those applied to the mutualistfungi (Wilson 1976; Wheeler 1984; Morelos-Juárez et al. 2010; Reber et al. 2011; Walker and Hughes 2011; Bos et al. 2012; Nilsson-Møller et al. 2018; Bos et al. 2019), thus suggesting the relevance of this behavior to remove contaminants.

Allogrooming complements self-grooming hence allowing two or more individuals to clean the body of a third party in places that this one cannot reach, thus clearing potential hazards (Hughes et al. 2002; Reber et al. 2011). However, the time investment in self-grooming was 10-fold higher than the time invested in allogrooming. The difference in the time investment between those behaviors is probably explained because allogrooming depends on the proportion of clean and contaminated workers. In carpenter and leaf-cutting ants, if the treatment is applied simultaneously to the majority of individuals in a group, then the investment in this behavior decreases versus the investment observed when there is a proportion of clean workers (Bos et al. 2012; Da Silva Camargo et al. 2017). In this situation, clean workers dedicate time to clean other workers in the group.

The workers did not alter the investment in fecal fluid grooming, thus suggesting that this behavior is not deployed in response to challenges with water or M. anisopliae. In agreement with those findings, Ac. echinatior workers perform fecal fluid grooming to prepare plant material for degradation in (Kooij et al. 2016). Similarly, fecal fluid grooming is performed by Ac. octospinosus minor workers when they incorporate plant material into the mutualist garden (Forti et al. 2020), and also by workers that make contact with the mutualist (Nilsson-Møller et al. 2018). Finally, it has been observed in foundress queens of Ac. octospinosus during the preparation of plant material to incorporate into the fungus garden (Fernández-Marín et al. 2003).

The deployment of hygienic behaviors led to the production of infrabuccal granules. An increase in infrabuccal pellet production has been previously described in Acromyrmex and Tachymirmex workers after exposure to Escovopsis and Penicillium (Fernández-Marín et al. 2006; Little et al. 2006). In line with these findings, the infrabuccal pocket has been described as a structure that compacts and possibly sterilizes the material removed by the workers during hygiene (Little et al. 2006). Furthermore, the final disposition of the pellets in the waste chambers helps isolate the potential hazard, thus protecting the workers and the fungus garden from further contamination (Currie and Stuart 2001; Little et al. 2003).

Atta cephalotes workers respond to the challenges applied in this study by modifying the time invested in the hygienic behaviors, but they could not produce a differential response between an innocuous challenge and an actual threat with an entomopathogen. This finding contrasts with previous reports, which show that leaf-cutting ants deploy a differential response against innocuous substances like talc and an actual threat (Fernández-Marín et al. 2006; Morelos-Juárez et al. 2010; Yek et al. 2013; Tranter et al. 2015; Nilsson-Møller et al. 2018). This finding cannot be attributed to the innocuity of the strain of M. anisopliae because the colonization assay and the survival curve showed that the strain of M. anisopliae has a virulence mechanism that allows it to reach the hemocoel of its host and significantly impacts its viability.

It is also possible that the application of the entomopathogen as a suspension of spores hinders the detection of specific cues by the workers. Although the mechanism that mediates the recognition of hazards in leaf-cutting is not well understood, microorganisms might release semiochemicals, volatile compounds detected by ants as cues of danger, thus triggering a prophylactic response (Davis et al. 2013; Goes et al. 2020). Thus, it is possible that those semiochemicals are diluted in suspension, thus hindering workers from detecting the threat. In this line of evidence, similar to the findings reported here, workers of Atta colombica did not generate a differential response to a suspension of spores of M. anisopliae and a challenge with a solution of detergent in water (Walker and Hughes 2011). Furthermore, workers of Formica selysi challenged with different concentrations of a suspension of Metarhizium bruneum spores at a concentration of 107 equivalent to the one used in this study workers produced a response similar to the one observed in control. In contrast, they deployed a differential response when they were challenged with a concentration of 108 spores/ml (Reber et al. 2011), thus supporting the idea that the concentration of the microorganisms is essential to its recognition and the scaling of the behavioral response against it.

Workers of A. cephalotes did not deploy the grooming of the metapleural gland in response to the challenge with M. anisopliae. This evidence is in contrast with a previous report showing that A. cephalotes workers increase the frequency of this behavior up to 150 times in response to a challenge with dry spores of Penicillium. This indicates that this is the primary mechanism of response against fungal threats among A. cephalotes (Fernández-Marín et al. 2006). The differences between these findings can be explained by the strategy used to deliver the challenge to the workers. Dry spores may elicit metapleural gland grooming because they are easily detected by ants whereas the cues released by the microorganisms are diluted in suspension, thus hindering recognition. Nevertheless, among workers of Ac. echinatior, the inoculation of the fungus garden with dry Escovopsis spores did not increase the frequency of metapleural grooming thus indicating that another factor is necessary to trigger this behavior (Nilsson-Møller et al. 2018). Recently, Tachymirmex workers have been shown to increase the frequency of metapleural gland grooming upon challenge with germinated spores of Metarhizium and Escovopsis versus the challenge with ungerminated conidia, thus suggesting that the status of the microorganisms also influences the workers’ response (Bonadies et al. 2019).

The evidence shows that although treatment with M. anisopliae spores, significantly impacts workers’ viability, the treatment with water also caused a reduction in this parameter. Previously, it has been shown that A. cephalotes workers lose viability when isolated on Petri dishes, even when left untreated (Valencia-Giraldo et al. 2021), possibly because they do not consume the agar diet. In contrast, colonies maintain their viability under laboratory conditions six weeks after the extraction (Valencia-Giraldo, personal observation). These findings suggest that experimental conditions may alter the health status of workers. Hence it cannot be ruled out that this factor may influence workers’ behavior avoiding the discrimination between a sham challenge and the challenge with an entomopathogen.

In terms of individual immunity, evidence shows that workers of A. cephalotes increase the expression of the antimicrobial peptide abaecin. The peak in the expression of abaecin at 48 h is consistent with the dynamics of invasion of M. anisopliae, which reaches the hemocoel between 24 and 48 h after hosts exposure (Moino Jr et al. 2002). In insect hosts, abaecin has shown antibacterial activity (Casteels et al. 1990; Otvos 2002; Rahnamaeian et al. 2015). However, the expression of this AMP in response to fungal infection has also been reported in Apis mellifera (Bull et al. 2012) and Ac. echinatior (Yek et al. 2013) suggesting that this peptide might protect against M. anisopliae.

In contrast, the expression of defensin was not altered in response to infection with M. anisopliae. This finding contrasts with evidence showing that expression of defensin in response to infection with M. anisopliae is increased in social insects including A. mellifera (Bull et al. 2012) and Lasius neglectus (Konrad et al. 2012) as well as in solitary insects like Aedes aegypti and Locusta migratoria (Cabral et al. 2020; Jiang et al. 2020). This finding may be explained by reducing genes related to individual immunity observed in A. cephalotes (Suen et al. 2011). However, the IMD and toll pathway genes responsible for the signaling transduction that lead to defensin expression and are functional in this species (Schlüns and Crozier 2007; Suen et al. 2011). Therefore, the explanation for the low defensin expression during the Metarhizium challenge remains unclear.

Conclusion

The results show for the first time that A. cephalotes workers deploy mechanisms of collective and individual immunity upon challenge with M. anisopliae spores. Under this particular experimental setup A. cephalotes workers cannot discriminate between a hazardous stimulus and an innocuous one; hence, they deploy a generic behavioral response independent of the level of threat posed by the challenge. In contrast, once M. anisopliae reaches the hemocoel, individual immunity recognizes the danger and triggers the expression of abaecin, possibly as a defense mechanism against the invader.

Acknowledgements

We would like to thank Vicerrectoria de Investigaciones of the Universidad del Valle for financial support through project grants number CI 71153. We thank Dr. James Montoya- Lerma and Inge Armbrecht and the members of the Group on Ecology of Agroecosystems and Natural Habitats (GEAHNA). We are grateful to Andrea López Peña and the DAGMA-Cali team, especially Diana Ortiz and Elsy Alvear, for support throughout the study.

This work was financed by Vicerrectoría de Investigaciones- Universidad del Valle grant number 53111: Defense strategies against bio-controllingfungi in leaf cutter ant Atta cephalotes (Hymenoptera: myrmicinae): synergism between individual and social immunity. Juan Sebastián Gómez Días was funded by Vicerrectoría de Investigaciones- Universidad del Valle Grant 71202.

References

  • Abramowski D, Currie CR, Poulsen M (2011) Caste specialization in behavioral defenses against fungus garden parasites in Acromyrmex octospinosus leaf-cutting ants. Insectes Sociaux 58: 65–75. https://doi.org/10.1007/s00040-010-0117-y
  • Bonadies E, Wcislo WT, Gálvez D, Hughes WOH, Fernández-Marín H (2019) Hygiene Defense Behaviors Used by a Fungus-Growing Ant Depend on the Fungal Pathogen Stages. Insects 10(5): 130. https://doi.org/10.3390/insects10050130
  • Bos N, Kankaanpää-Kukkonen V, Freitak D, Stucki D, Sundström L (2019) Comparison of twelve ant species and their susceptibility to fungal infection. Insects 10(9): 271. https://doi.org/10.3390/insects10090271
  • Branstetter MG, Ješovnik A, Sosa-Calvo J, Lloyd MW, Faircloth BC, Brady SG, Schultz TR (2017) Dry habitats were crucibles of domestication in the evolution of agriculture in ants. Proceedings of the Royal Society B: Biological Sciences 284: e20170095. https://doi.org/10.1098/rspb.2017.0095
  • Buchon N, Silverman N, Cherry S (2014) Immunity in Drosophila melanogaster — from microbial recognition to whole-organism physiology. Nature Reviews Immunology 14: 796–810. https://doi.org/10.1038/nri3763
  • Bueno OC, Morini MS, Pagnocca FC, Hebling MJ, Silva OA (1997) Sobrevivência de operárias de Atta sexdens rubropilosa Forel (Hymenoptera: Formicidae) isoladas do formigueiro e alimentadas com dietas artificiais. Anais da Sociedade Entomológica do Brasil 26: 107–113. https://doi.org/10.1590/S0301-80591997000100015
  • Bull JC, Ryabov EV, Prince G, Mead A, Zhang C, Baxter LA, Pell JK, Osborne JL, Chandler D (2012) A strong immune response in young adult honeybees masks their increased susceptibility to infection compared to older bees. PLoS Pathog 8(12): e1003083. https://doi.org/10.1371/journal.ppat.1003083
  • Cabral S, de Paula A, Samuels R, da Fonseca R, Gomes S, Silva JR, Mury F (2020) Aedes aegypti (Diptera: Culicidae) Immune Responses with Different Feeding Regimes Following Infection by the Entomopathogenic Fungus Metarhizium anisopliae. Insects 11(2): 95. https://doi.org/10.3390/insects11020095
  • Cafaro MJ, Poulsen M, Little AE, Price SL, Gerardo NM, Wong B, Stuart AE, Larget B, Abbot P, Currie CR (2011) Specificity in the symbiotic association between fungus-growing ants and protective Pseudonocardia bacteria. Proceedings of the Royal Society B: Biological Sciences 278: 1814–1822. https://doi.org/10.1098/rspb.2010.2118
  • Calheiros AC, Ronque MUV, Oliveira PS (2019) Social organization and subcaste specialization in the leaf-cutting ant Acromyrmex subterraneus (Formicidae: Myrmicinae). Journal of Insect Behavior 32: 267–280. https://doi.org/10.1007/s10905-019-09729-6
  • Casteels P, Ampe C, Riviere L, van Damme J, Elicone C, Fleming M, Jacobs F, Tempst P (1990) Isolation and characterization of abaecin, a major antibacterial response peptide in the honeybee (Apis mellifera). European Journal of Biochemistry 187: 381–386. https://doi.org/10.1111/j.1432-1033.1990.tb15315.x
  • Chérasse S, Baer B, Schiøtt M, Boomsma JJ (2018) Differential immune gene expression in sperm storage organs of leaf-cutting ants. Journal of Experimental Biology 221(6): jeb173435. https://doi.org/10.1242/jeb.173435
  • Core-Team R (2020) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, 201 pp.
  • Currie CR, Poulsen M, Mendenhall J, Boomsma JJ, Billen J (2006) Coevolved crypts and exocrine glands support mutualistic bacteria in fungus-growing ants. Science 311: 81–83. https://doi.org/10.1126/science.1119744
  • Currie CR, Scott JA, Summerbell RC, Malloch D (1999) Fungus-growing ants use antibiotic producing bacteria to control garden parasites. Nature 398: 701–704. https://doi.org/10.1038/19519
  • Currie CR, Wong B, Stuart AE, Schultz TR, Rehner SA, Mueller UG, Sung GH, Spatafora JW, Straus NA (2003) Ancient tripartite coevolution in the attine ant-microbe symbiosis. Science 299: 386–388. https://doi.org/10.1126/science.1078155
  • Da Silva Camargo R, Puccini C, Forti LC (2017) Allogrooming, self-grooming, and touching behavior: Contamination routes of leaf-cutting ant workers using a fat-soluble tracer dye. Insects 8(2): 59. https://doi.org/10.3390/insects8020059
  • Do Nascimento RR, Schoeters E, Morgan ED, Billen J, Stradling DJ (1996) Chemistry of metapleural gland secretions of three attine ants, Atta sexdens rubropilosa, Atta cephalotes, and Acromyrmex octospinosus (Hymenoptera: Formicidae). Journal of Chemical Ecology 22: 987–1000. https://doi.org/10.1007/BF02029949
  • Estrada C, Wcislo WT, Van Bael SA (2013) Symbioticfungi alter plant chemistry that discourages leaf-cutting ants. New Phytologist 198: 241–251. https://doi.org/10.1111/nph.12140
  • Evans JD, Aronstein K, Chen YP, Hetru C, Imler JL, Jiang H, Kanost M, Thompson GJ, Zou Z, Hultmark D (2006) Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Molecular Biology 15: 645–656. https://doi.org/10.1111/j.1365-2583.2006.00682.x
  • Fernández-Marín H, Nash DR, Higginbotham S, Estrada C, van Zweden JS, d’Ettorre P, Wcislo WT, Boomsma JJ (2015) Functional role of phenylacetic acid from metapleural gland secretions in controlling fungal pathogens in evolutionarily derived leaf-cutting ants. Proceedings of the Royal Society B: Biological Sciences 282: e20150212. https://doi.org/10.1098/rspb.2015.0212
  • Fernández-Marín H, Zimmerman JK, Nash DR, Boomsma JJ, Wcislo WT (2009) Reduced biological control and enhanced chemical pest management in the evolution of fungus farming in ants. Proceedings of the Royal Society B: Biological Sciences 276: 2263–2269. https://doi.org/10.1098/rspb.2009.0184
  • Fernández-Marín H, Zimmerman JK, Rehner SA, Wcislo WT (2006) Active use of the metapleural glands by ants in controlling fungal infection. Proceedings of the Royal Society 273: 1689–1695. https://doi.org/10.1098/rspb.2006.3492
  • Fernández-Marín H, Zimmermann JK, Wcislo WT (2003) Nest-founding in Acromyrmex octospinosus (Hymenoptera, Formicidae, Attini): demography and putative prophylactic behaviors. Insectes Sociaux 50: 304–308. https://doi.org/10.1007/s00040-003-0687-z
  • Folgarait PJ, Dyer LA, Marquis RJ, Braker HE (1996) Leaf-cutting ant preferences for five native tropical plantation tree species growing under different light conditions. Entomologia Experimentalis et Applicata 80: 521–530. https://doi.org/10.1111/j.1570-7458.1996.tb00968.x
  • Forti LC, Andrade APP, Sousa KKA, Camargo RS, Matos CAO, Caldato N, Catalani GC, Ramos VM (2020) Do Workers from subspecies Acromyrmex subterraneus prepare leaves and toxic baits in similar ways for their fungus garden? Neotropical Entomology 49: 12–23. https://doi.org/10.1007/s13744-019-00708-2
  • Fox J, Weisberg S (2018) An R companion to applied regression. Sage publications, 8 pp.
  • Goes AC, Barcoto MO, Kooij PW, Bueno OC, Rodrigues A (2020) How do leaf-cutting ants recognize antagonistic microbes in their fungal crops? Frontiers in Ecology and Evolution 8: 95. https://doi.org/10.3389/fevo.2020.00095
  • Heine D, Holmes NA, Worsley SF, Santos ACA, Innocent TM, Scherlach K, Patrick EH, Yu DW, Murrell JC, Vieria PC, Boomsma JJ, Hertweck C, Hutchings MI, Wilkinson B (2018) Chemical warfare between leafcutter ant symbionts and a co-evolved pathogen. Nature Communications 9: e2208. https://doi.org/10.1038/s41467-018-04520-1
  • Hölldobler B, Wilson EO (2010) The leafcutter ants: civilization by instinct. WW Norton & Company, 158 pp.
  • Hothorn T, Bretz F, Westfall P, Heiberger RM, Schuetzenmeister A, Scheibe S, Hothorn MT (2016) Package ‘multcomp’. Simultaneous inference in general parametric models Project for Statistical Computing, Vienna, 36 pp.
  • Hughes WOH, Eilenberg J, Boomsma JJ (2002) Trade-offs in group living: transmission and disease resistance in leaf-cutting ants. Proceedings of the Royal Society of London Series B: Biological Sciences 269: 1811–1819. https://doi.org/10.1098/rspb.2002.2113
  • Jiang W, Peng Y, Ye J, Wen Y, Liu G, Xie J (2020) Effects of the Entomopathogenic Fungus Metarhizium anisopliae on the Mortality and Immune Response of Locusta migratoria. Insects 12(1): 1. https://doi.org/10.3390/insects12010001
  • Jonkman JCM (1980) The external and internal structure and growth of nests of the leaf-cutting ant Atta vollenweideri Forel, 1893 (Hym.: Formicidae). Zeitschrift für Angewandte Entomologie 89: 217–246. https://doi.org/10.1111/j.1439-0418.1980.tb03461.x
  • Kleineidam C, Roces F (2000) Carbon dioxide concentrations and nest ventilation in nests of the leaf-cutting ant Atta vollenweideri. Insectes Sociaux 47: 241–248. https://doi.org/10.1007/PL00001710
  • Konrad M, Vyleta ML, Theis FJ, Stock M, Tragust S, Klatt M, Drescher V, Marr C, Ugelvig LV, Cremer S (2012) Social transfer of pathogenic fungus promotes active immunisation in ant colonies. PLoS Biology 10(4): e1001300. https://doi.org/10.1371/journal.pbio.1001300
  • Kooij PW, Pullens JWM, Boomsma JJ, Schiøtt M (2016) Ant mediated redistribution of a xyloglucanase enzyme in fungus gardens of Acromyrmex echinatior. BMC Microbiology 16: e81. https://doi.org/10.1186/s12866-016-0697-4
  • Li H, Sun C-Y, Fang Y, Carlson CM, Xu H, Ješovnik A, Sosa-Calvo J, Zarnowski R, Bechtel HA, Fournelle JH, Andes DR, Schultz TR, Gilbert PUPA, Currie CR (2020) Biomineral armor in leaf-cutter ants. Nature Communications 11: e5792. https://doi.org/10.1038/s41467-020-19566-3
  • Little AEF, Murakami T, Mueller UG, Currie CR (2006) Defending against parasites: fungus-growing ants combine specialized behaviours and microbial symbionts to protect their fungus gardens. Biology Letters 2: 12–16. https://doi.org/10.1098/rsbl.2005.0371
  • Littledyke M, Cherrett J (1978) Defence mechanisms in young and old leaves against cutting by the leaf-cutting ants Atta cephalotes (L.) and Acromyrmex octospinosus (Reich)(Hymenoptera: Formicidae). Bulletin of Entomological Research 68: 263–271. https://doi.org/10.1017/S0007485300007343
  • Moino Jr A, Alves SB, Lopes RB, Neves PMOJ, Pereira RM, Vieira SA (2002) External development of the entomopathogenicfungi Beauveria bassiana and Metarhizium anisopliae in the subterranean termite Heterotermes tenuis. Scientia agricola 59: 267–273. https://doi.org/10.1590/S0103-90162002000200010
  • Moreira A, Forti LC, Andrade AP, Boaretto MA, Lopes J (2004) Nest Architecture of Atta laevigata (F. Smith, 1858) (Hymenoptera: Formicidae). Studies on Neotropical Fauna and Environment 39: 109–116. https://doi.org/10.1080/01650520412331333756
  • Moreira AC, dos Santos AM, Carneiro RL, Bueno OC, Souza DHF (2017) Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in different developmental stages and tissues. International Journal of Environment, Agriculture and Biotechnology 2: e238725. https://doi.org/10.22161/ijeab/2.2.23
  • Morelos-Juárez C, Walker TN, Lopes JFS, Hughes WOH (2010) Ant farmers practice proactive personal hygiene to protect their fungus crop. Current Biology 20(13): R553–R554. https://doi.org/10.1016/j.cub.2010.04.047
  • Muchovej J, Della Lucia T (1990) Escovopsis, a new genus from leaf cutting ant nests to replace Phialocladus nomen invalidum. Mycotax 37: 191–195.
  • Mueller UG, Schultz TR, Currie CR, Adams RMM, Malloch D (2001) The origin of the attine ant-fungus mutualism. The Quarterly Review of Biology 76: 169–197. https://doi.org/10.1086/393867
  • Nappi AJ, Christensen BM (2005) Melanogenesis and associated cytotoxic reactions: applications to insect innate immunity. Insect Biochemistry and Molecular Biology 35: 443–459. https://doi.org/10.1016/j.ibmb.2005.01.014
  • Nilsson-Møller S, Poulsen M, Innocent TM (2018) A visual guide for studying behavioral defenses to pathogen attacks in leaf-cutting ants. Journal of visualized experiments (JoVE) 140: e58420. https://doi.org/10.3791/58420
  • Pie MR, Rosengaus RB, Traniello JFA (2004) Nest architecture, activity pattern, worker density and the dynamics of disease transmission in social insects. Journal of Theoretical Biology 226: 45–51. https://doi.org/10.1016/j.jtbi.2003.08.002
  • Pinheiro J, Bates DM (2022) Package ‘nlme’. Linear and nonlinear mixed effects models, version, 338 pp.
  • Poulsen M, Bot AN, Boomsma JJ (2003) The effect of metapleural gland secretion on the growth of a mutualistic bacterium on the cuticle of leaf-cutting ants. Naturwissenschaften 90: 406–409. https://doi.org/10.1007/s00114-003-0450-3
  • Poulsen M, Cafaro MJ, Erhardt DP, Little AEF, Gerardo NM, Tebbets B, Klein BS, Currie CR (2010) Variation in Pseudonocardia antibiotic defence helps govern parasite-induced morbidity in Acromyrmex leaf-cutting ants. Environmental Microbiology Reports 2: 534–540. https://doi.org/10.1111/j.1758-2229.2009.00098.x
  • Rahnamaeian M, Cytryńska M, Zdybicka-Barabas A, Dobslaff K, Wiesner J, Twyman RM, Zuchner T, Sadd BM, Regoes RR, Schmid-Hempel P, Vilcinskas A (2015) Insect antimicrobial peptides show potentiating functional interactions against Gram-negative bacteria. Proceedings of the Royal Society 282: e20150293. https://doi.org/10.1098/rspb.2015.0293
  • Revelle W (2022) psych: Procedures for Psychological, Psychometric, and Personality Research. 387 pp.
  • Richard FJ, Errard C (2009) Hygienic behavior, liquid-foraging, and trophallaxis in the leaf-cutting ants, Acromyrmex subterraneus and Acromyrmex octospinosus. Journal of Insect Science 9(1): 1–9. https://doi.org/10.1673/031.009.6301
  • Rocha SL, Evans HC, Jorge VL, Cardoso LAO, Pereira FST, Rocha FB, Barreto RW, Hart AG, Elliot SL (2017) Recognition of endophytic Trichoderma species by leaf-cutting ants and their potential in a Trojan-horse management strategy. Royal Society Open Science 4: e160628. https://doi.org/10.1098/rsos.160628
  • Rodrigues A, Cable RN, Mueller UG, Bacci M, Pagnocca FC (2009) Antagonistic interactions between garden yeasts and microfungal garden pathogens of leaf-cutting ants. Antonie Van Leeuwenhoek 96: 331–342. https://doi.org/10.1007/s10482-009-9350-7
  • Rodrigues A, Carletti CD, Bueno OC, Pagnocca FC (2008) Leaf-cutting ant faecal fluid and mandibular gland secretion: effects on microfungi spore germination. Brazilian Journal of Microbiology 39: 64–67. https://doi.org/10.1590/S1517-83822008000100016
  • Schlüns H, Crozier RH (2007) Relish regulates expression of antimicrobial peptide genes in the honeybee, Apis mellifera, shown by RNA interference. Insect Molecular Biology 16(6): 753–759. https://doi.org/10.1111/j.1365-2583.2007.00768.x
  • Suen G, Teiling C, Li L, Holt C, Abouheif E, Bornberg-Bauer E, Bouffard P, Caldera EJ, Cash E, Cavanaugh A, Denas O, Elhaik E, Favé MJ, Gadau J, Gibson JD, Graur D, Grubbs KJ, Hagen DE, Harkins TT, Helmkampf M, Hu H, Johnson BR, Kim J, Marsh SE, Moeller JA, Muñoz-Torres MC, Murphy MC, Naughton MC, Nigam S, Overson R, Rajakumar R, Reese JT, Scott JJ, Smith CR, Tao S, Tsutsui ND, Viljakainen L, Wissler L, Yandell MD, Zimmer F, Taylor J, Slater SC, Clifton SW, Warren WC, Elsik CG, Smith CD, Weinstock GM, Gerardo NM, Currie CR (2011) The genome sequence of the leaf-cutter ant Atta cephalotes reveals insights into its obligate symbiotic lifestyle. PLoS Genet 7(2): e1002007. https://doi.org/10.1371/journal.pgen.1002007
  • Therneau TM (2022) A Package for Survival Analysis in R. 98 pp.
  • Therneau TM, Grambsch PM (2000) The Cox Model. In: Therneau TM, Grambsch PM (Eds) Modeling Survival Data: Extending the Cox Model. Springer New York, New York, NY, 39–77. https://doi.org/10.1007/978-1-4757-3294-8_3
  • Tranter C, LeFevre L, Evison SEF, Hughes WOH (2015) Threat detection: contextual recognition and response to parasites by ants. Behavioral Ecology 26: 396–405. https://doi.org/10.1093/beheco/aru203
  • Valderrama EI, Giraldo C, Montoya-Lerma J, Ambrecht I, Calle Z (2006) Guía para el establecimiento y manejo de colonias artificiales de hormiga arriera Atta cephalotes (Hymenoptera: Myrmicinae). Boletín del Museo de Entomología de la Universidad del Valle 7: 9–16.
  • Verza SS, Diniz EA, Chiarelli MF, Mussury RM, Bueno OC (2017) Waste of leaf-cutting ants: disposal, nest structure, and abiotic soil factors around internal waste chambers. Acta Ethol 20: 119–126. https://doi.org/10.1007/s10211-017-0255-6
  • Ward PS, Brady SG, Fisher BL, Schultz TR (2015) The evolution of myrmicine ants: phylogeny and biogeography of a hyperdiverse ant clade (Hymenoptera: Formicidae). Systematic Entomology 40: 61–81. https://doi.org/10.1111/syen.12090
  • Wheeler DE (1984) Behavior of the ant, Procryptocerus scabriusculus (Hymenoptera: Formicidae), with comparisons to other Cephalotines. Psyche 91: 171–192. https://doi.org/10.1155/1984/65369
  • Yanagawa A, Yokohari F, Shimizu S (2008) Defense mechanism of the termite, Coptotermes formosanus Shiraki, to entomopathogenicfungi. Journal of Invertebrate Pathology 97: 165–170. https://doi.org/10.1016/j.jip.2007.09.005
  • Yek SH, Boomsma JJ, Schiøtt M (2013) Differential gene expression in Acromyrmex leaf-cutting ants after challenges with two fungal pathogens. Molecular Ecology 22: 2173–2187. https://doi.org/10.1111/mec.12255
  • Zhang Z, Zhu S (2012) Comparative genomics analysis of five families of antimicrobial peptide-like genes in seven ant species. Developmental & Comparative Immunology 38(2): 262–274. https://doi.org/10.1016/j.dci.2012.05.003